ID: 1066668027

View in Genome Browser
Species Human (GRCh38)
Location 10:37805539-37805561
Sequence AGGTTTTTACAGAGTGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066668027_1066668031 2 Left 1066668027 10:37805539-37805561 CCACATTCACTCTGTAAAAACCT 0: 1
1: 0
2: 5
3: 29
4: 248
Right 1066668031 10:37805564-37805586 CCCTTATGCTTCTTTTGGTTTGG No data
1066668027_1066668029 -3 Left 1066668027 10:37805539-37805561 CCACATTCACTCTGTAAAAACCT 0: 1
1: 0
2: 5
3: 29
4: 248
Right 1066668029 10:37805559-37805581 CCTGTCCCTTATGCTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066668027 Original CRISPR AGGTTTTTACAGAGTGAATG TGG (reversed) Intronic
901865857 1:12106322-12106344 AGGATTTGACTAAGTGAATGGGG - Intronic
902288327 1:15420940-15420962 AGATTATTAAAGAGTAAATGAGG - Intronic
902433274 1:16380140-16380162 AGGGTTTTAGAAAGTGACTGTGG + Intronic
903368850 1:22821871-22821893 TGGTTTTTGCTTAGTGAATGTGG + Intronic
903468867 1:23571006-23571028 CAGTTTTTTCAGAGTGACTGTGG + Intergenic
908082160 1:60592728-60592750 AATGTTTTACAGAGGGAATGAGG + Intergenic
911721616 1:101197271-101197293 AGGTTTTCAATCAGTGAATGTGG + Intergenic
911882028 1:103251934-103251956 AGGTTTTTGCAGAGGTAATCAGG - Intergenic
912193165 1:107364897-107364919 ACTTTTTTACATAATGAATGAGG - Intronic
914412635 1:147446054-147446076 GGGTTTACACAGAATGAATGTGG - Intergenic
915836759 1:159183006-159183028 AGGCTTTTCCAGGCTGAATGAGG - Intronic
916477051 1:165179745-165179767 TGGTTTTTACAGAGAGAATGTGG + Intergenic
917700542 1:177576224-177576246 AGGTTTAAACAGAGTGGATAGGG - Intergenic
918801042 1:188972095-188972117 AGGATTTTAAAGGGAGAATGAGG + Intergenic
919799190 1:201342791-201342813 GTGCTTTTAGAGAGTGAATGTGG + Intergenic
920370206 1:205474016-205474038 TGGCTTCTGCAGAGTGAATGAGG - Intergenic
921919747 1:220654353-220654375 AGGATTTCAAAGAGTGGATGTGG + Intronic
922094885 1:222434867-222434889 AGGAGTTTACAGAGGGTATGGGG + Intergenic
923127452 1:231044759-231044781 AAGCTTTTATAGGGTGAATGAGG - Intergenic
924274143 1:242368234-242368256 AGGCTTTTATAGGGTGAATACGG - Intronic
1063085910 10:2817631-2817653 AGGTCTTTACAGAGAAAATAAGG - Intergenic
1063906989 10:10791254-10791276 AGATTTTTATAGATTGAGTGTGG + Intergenic
1064726783 10:18288131-18288153 AGGTCTTTACAGAGGTAATCAGG - Intronic
1065015280 10:21457120-21457142 AGGCCTTTACAGAGGTAATGAGG - Intergenic
1065154108 10:22852167-22852189 AGGTTTGTACAAAGGAAATGGGG + Intergenic
1066668027 10:37805539-37805561 AGGTTTTTACAGAGTGAATGTGG - Intronic
1068185408 10:53578898-53578920 ATGTTTATACAGAGTTAAAGGGG + Intergenic
1070888399 10:79924175-79924197 AGCTTTTCACAGAGTTAAAGTGG - Intergenic
1071016945 10:81008636-81008658 AGATTTTGGCAGAGTAAATGTGG - Intergenic
1071476904 10:86032926-86032948 AGGTTTTTAAAGAATAAATCAGG + Intronic
1075023773 10:118969021-118969043 AGATGTTTACAGAATGAAAGGGG - Intergenic
1075198625 10:120382786-120382808 AGGTTGTTAGAAGGTGAATGAGG - Intergenic
1076017156 10:127037052-127037074 TGGTTTTTAAAGAGTCAATGTGG - Intronic
1076060542 10:127410837-127410859 CAGTTTTTACAGGGTGAACGAGG + Exonic
1076216168 10:128695149-128695171 AATTTTTAACAGAATGAATGTGG + Intergenic
1077757713 11:5052722-5052744 AGGTTCTTACACTGTGCATGAGG - Intergenic
1078539588 11:12202365-12202387 ATGCTTTTACAGATTGAAAGGGG - Intronic
1079474927 11:20820223-20820245 AGGTATATACAGAATGTATGAGG + Intronic
1081040986 11:38212086-38212108 AGGATTTTATAGAGAAAATGAGG - Intergenic
1082857188 11:57818430-57818452 AAGTTTTTAAAGTGTGTATGTGG + Exonic
1084727115 11:70949218-70949240 AGGCTCTTGCAGACTGAATGAGG - Intronic
1085187917 11:74592105-74592127 AGGTTTTTCCAGAGGGGTTGAGG - Intronic
1086501833 11:87461682-87461704 AGGATTTTAAAGAATGAAAGCGG - Intergenic
1087738964 11:101866139-101866161 AAGTTTTTAAAAAGAGAATGAGG + Intronic
1088767903 11:113002476-113002498 ACCTTTTTACAAAATGAATGTGG + Intronic
1090692041 11:129194096-129194118 AGGTTTTAACAAACTGAAAGAGG + Intronic
1092324492 12:7515455-7515477 AGGTTTTTAAAGAAAAAATGAGG + Intergenic
1093505981 12:19866590-19866612 TGGTCGTTTCAGAGTGAATGAGG + Intergenic
1093671949 12:21886959-21886981 AGGGTATTAGAGAGTGAATTGGG - Intronic
1095645198 12:44536220-44536242 AAGTATTTACTGAGTGAATAAGG - Intronic
1095906430 12:47382867-47382889 AGGTCTTTACAGAGGTAATTGGG - Intergenic
1096273636 12:50187042-50187064 AGGATATTCTAGAGTGAATGAGG + Intronic
1096400501 12:51302184-51302206 AGGTTTTTGCAGGGAGAATTTGG - Intronic
1096502167 12:52070636-52070658 AGGTTTTCACAGACCAAATGTGG + Intronic
1096553013 12:52385962-52385984 AGGTTTTTTCACTGTGAGTGTGG + Intergenic
1096941692 12:55353767-55353789 AGATTTTAATACAGTGAATGAGG - Intergenic
1098098715 12:66989329-66989351 AAGTTTTTACTGAATGAATGTGG + Intergenic
1099360715 12:81696581-81696603 ATATTTTTACAGATCGAATGGGG + Intronic
1102483817 12:113242763-113242785 AGGTATTCACAGGGTGGATGGGG - Intronic
1103149543 12:118624943-118624965 AGGTTTTCACTTGGTGAATGGGG + Intergenic
1105542177 13:21325395-21325417 AGCCTTTTACTGATTGAATGAGG - Intergenic
1106243961 13:27931141-27931163 AGGTGATTTCAGAGTGAAAGTGG + Intergenic
1107827494 13:44342003-44342025 GGCTTTTGACAGAGTGGATGAGG - Intergenic
1108649009 13:52457331-52457353 AGCTTTTTACTCAGTGTATGGGG + Intronic
1109054647 13:57532171-57532193 AGGTTTTTACAGAGAAAGAGAGG + Intergenic
1109179185 13:59192643-59192665 GGGTTTTTACAGACTAAATGCGG - Intergenic
1110615843 13:77541044-77541066 TGGCTTTTAAAGAGTGAAAGTGG + Intronic
1110879141 13:80549121-80549143 AGGTTGTTACAAAGTTGATGAGG - Intergenic
1111829013 13:93303111-93303133 AGGCTTTTATAGACAGAATGTGG - Intronic
1112821767 13:103345988-103346010 AGGAGTTTACAGTGGGAATGTGG + Intergenic
1113942590 13:114026113-114026135 ACGTCTTTACAGAGTGAAACAGG + Intronic
1115093480 14:29606679-29606701 AGGTTTTCACAATGTAAATGAGG - Intronic
1115121999 14:29948434-29948456 AATATTTTCCAGAGTGAATGTGG - Intronic
1115725147 14:36206148-36206170 ATCTTTTTACAGAGTCAGTGTGG + Intergenic
1116749361 14:48863664-48863686 AGGATTGTATAGAGAGAATGTGG + Intergenic
1116900828 14:50361285-50361307 GGGATTTTACAGAGAAAATGAGG - Intronic
1118085645 14:62413042-62413064 AGGGTTTTACATACTGAACGAGG - Intergenic
1118951371 14:70439227-70439249 AGGTTTTTACCCAGTGGAGGAGG + Intergenic
1119175335 14:72564444-72564466 AGGTTTATACAAAGAGAAAGAGG - Intronic
1124061252 15:26295487-26295509 AGGTTTCTCCAGAGTGGATCAGG + Intergenic
1130369480 15:83272535-83272557 TTGTTTTTAAAGAGTGAATGGGG - Intronic
1132016081 15:98318519-98318541 AGGCTTTTGTAGAGTGAATGGGG - Intergenic
1132256884 15:100383894-100383916 AGGTTTTTAAAGAGAGAGAGGGG - Intergenic
1134564387 16:15238502-15238524 AGTTTTTTTCACAGTAAATGGGG - Intergenic
1134738108 16:16518197-16518219 AGTTTTTTTCACAGTAAATGGGG + Intergenic
1134929392 16:18193966-18193988 AGTTTTTTTCACAGTAAATGGGG - Intergenic
1135235783 16:20754559-20754581 GGGTGTTTATAGGGTGAATGTGG - Intronic
1136140925 16:28288167-28288189 AAGTTTTTACAAAGTCAAGGGGG + Intergenic
1136673008 16:31874472-31874494 AGGTTTTTATAAGGTGCATGAGG + Intronic
1139669943 16:68485741-68485763 AGGGTTTTAATGAGAGAATGTGG + Intergenic
1140417848 16:74789247-74789269 AGAAGTTTACAGAGTGAGTGAGG + Intergenic
1140507483 16:75482885-75482907 AGGTTTTCCCAGAGTGGCTGTGG - Intronic
1141142866 16:81508666-81508688 AGGTATTTACAGACTGCATTGGG + Intronic
1141561384 16:84870048-84870070 CGGCTTCTACAGAGAGAATGAGG - Intronic
1141853226 16:86662299-86662321 AGGAATTTCCAGAGTAAATGAGG + Intergenic
1144519161 17:15942915-15942937 TGGCTTTTACAGAGTGAGGGAGG - Intergenic
1149271789 17:54987257-54987279 AACTTTTTATAGAGGGAATGAGG - Intronic
1149685541 17:58532459-58532481 AGGTTTTCACAAAGTGAATCCGG + Intronic
1149981435 17:61314433-61314455 ATGTTCTTAGAGAGGGAATGCGG - Intronic
1153230409 18:2930027-2930049 AAGTTCTTGCAGAGTGAATGAGG + Intronic
1154292671 18:13123687-13123709 AGTTATTCACAGTGTGAATGAGG - Intronic
1155206816 18:23565818-23565840 AGGATTTTCCAGAGTGGATAAGG - Intronic
1155422556 18:25670804-25670826 AGGATTTTATAGGGTGAATGTGG - Intergenic
1156622913 18:38873847-38873869 AGGCTTTTACATGGTGAATGGGG + Intergenic
1157733935 18:50029902-50029924 AGGTTTTCAGTGAGAGAATGTGG - Intronic
1159853700 18:73558614-73558636 AGTATTTTACAGAGTGAAAAAGG - Intergenic
1159884943 18:73894934-73894956 TGGGTTTTACTGTGTGAATGCGG + Intergenic
1160335267 18:78033054-78033076 AGGTGTTTTCAGTGAGAATGGGG - Intergenic
1161589845 19:5124382-5124404 AGGCTTTTACAGAGTGGAGCTGG + Intronic
1161649384 19:5474925-5474947 AGGTGTCCACAGAGTGAAGGTGG + Intergenic
1163106850 19:15128391-15128413 ATGATTTTACAGACTGCATGAGG + Intergenic
1163503116 19:17687836-17687858 AGGTTTTTAGAGGGTCAGTGAGG - Intronic
1164422493 19:28106923-28106945 CAGCTTTTACAGAGTGGATGGGG - Intergenic
1164445121 19:28310560-28310582 AGTTGGTGACAGAGTGAATGTGG + Intergenic
1165010693 19:32844118-32844140 GGGTTTTGGCAGAGTGAGTGAGG + Intronic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
1167423642 19:49418128-49418150 AGTGTTTTTCAGTGTGAATGAGG - Intergenic
1168090850 19:54082471-54082493 AGGTTTTTAAAGAATAAATCAGG + Intergenic
925529123 2:4840049-4840071 AGGTTTTCCCAGAGTGAATTCGG - Intergenic
925694357 2:6560104-6560126 AGGTTTTTAAATATGGAATGTGG + Intergenic
926026194 2:9547006-9547028 AGTTTTTTAAAGAGAGAATATGG - Intronic
926332816 2:11838928-11838950 GTATTTTTCCAGAGTGAATGGGG + Intergenic
926532681 2:14070123-14070145 AGGTATTAACAGAGACAATGAGG - Intergenic
929633070 2:43486390-43486412 CGATTTTTACAGAGTAATTGAGG - Intronic
932068727 2:68594358-68594380 GGATTGATACAGAGTGAATGAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937708502 2:124949818-124949840 AGGTTGTTACAAAGTAATTGCGG + Intergenic
937841730 2:126531153-126531175 AGAAATTTACAGACTGAATGGGG + Intergenic
938945590 2:136209184-136209206 ATGTTGTTACAGAGCGGATGAGG + Intergenic
941889042 2:170559038-170559060 AGTTTTCTACAGAGTTAATATGG + Intronic
942173350 2:173308420-173308442 AGGATTTTACTGAGTGATGGAGG - Intergenic
943965258 2:194324642-194324664 AGGTTTTTACACAAACAATGTGG - Intergenic
944681353 2:202079952-202079974 AGGCTTGTGCAGATTGAATGAGG - Intronic
945322420 2:208440807-208440829 AGGTCTTCACCGAGTGCATGGGG + Intronic
946510887 2:220355107-220355129 TGTGTTTTACAGAGGGAATGGGG - Intergenic
946657862 2:221967931-221967953 AGGTTTTTAAAGAAAAAATGAGG + Intergenic
947335760 2:229081037-229081059 AGGTTTTTAGAGAAAAAATGAGG - Intronic
948186139 2:236023019-236023041 AGGATTTTACAAAGTGTATGAGG + Intronic
948756360 2:240161780-240161802 GGGTCTTTACAGAGGTAATGAGG - Intergenic
948902909 2:240965193-240965215 AGGTGTCTACAGAGTGGCTGAGG + Intronic
1168865624 20:1083628-1083650 AGGCTTTTATAGGGTGAATGTGG - Intergenic
1169615067 20:7432585-7432607 AGGCTTTTATAGAGTGAAAATGG + Intergenic
1170872490 20:20219604-20219626 AGGTTTTTGGAGAATGTATGGGG - Intronic
1171424582 20:25041612-25041634 ATGTTTTCCCAGTGTGAATGGGG - Intronic
1172442363 20:34974961-34974983 AGGTTCTCACAGAGACAATGCGG + Intergenic
1172954948 20:38749525-38749547 AGGCTTTTACTGAGTGAAATGGG + Intronic
1173071673 20:39774208-39774230 TGGTGTTTACAGTTTGAATGTGG - Intergenic
1173120173 20:40281977-40281999 GGGTTTTTACATTTTGAATGAGG + Intergenic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1176209613 20:63912406-63912428 ATGTATTTACAGAGTTAATTGGG + Intronic
1177579328 21:22999197-22999219 AGGTTTTTAATGACTGCATGAGG - Intergenic
1179309164 21:40181627-40181649 AGGTGTTTTCAGAGAGTATGTGG - Intronic
1183166021 22:36148063-36148085 AGGTATTTATAGGGTGAATATGG - Intronic
1184724200 22:46333960-46333982 AGGTTTTTAAAGGGAAAATGAGG - Intronic
1184932027 22:47688404-47688426 AAGCTTTTATAGGGTGAATGTGG + Intergenic
1185120482 22:48964321-48964343 AGGGATTTGCAGAGTGAATGTGG + Intergenic
1185270205 22:49926394-49926416 AGGGTTTTTCAGAATGAATAAGG + Intronic
949130057 3:488903-488925 AGGCTTTTACAGGGTGAATGTGG - Intergenic
949675981 3:6453927-6453949 ACTTTATTACAGAGTGAATGTGG + Intergenic
950065820 3:10110758-10110780 AGCTTTTGGCAGAGTAAATGTGG - Intergenic
950595601 3:13978294-13978316 AGCTTTGTGAAGAGTGAATGAGG + Intronic
952890985 3:38040598-38040620 AAGTCTTAGCAGAGTGAATGTGG - Intronic
953471351 3:43169391-43169413 AGGTTCTGGCAGAGTGGATGAGG - Intergenic
953857439 3:46510477-46510499 AGATGTTTACAAAGGGAATGAGG - Intergenic
954427404 3:50450659-50450681 AGGCTTTTACAGAGTGAAAGAGG + Intronic
954958853 3:54547128-54547150 AGGAATTTATAGGGTGAATGAGG + Intronic
958748878 3:98171198-98171220 AGGCTTTTACAGGGCAAATGTGG + Intronic
959498376 3:107076970-107076992 AGGTCTTCACAGGGTTAATGAGG - Intergenic
959571091 3:107884962-107884984 AGGATTTTCCAGAGTAACTGAGG + Intergenic
962452588 3:135532980-135533002 AGGTTTTTACTGAGTGGATGTGG + Intergenic
962846332 3:139277333-139277355 AGATGTTTATAGAGGGAATGGGG + Intronic
963417756 3:145020082-145020104 ACGTCTTTAGAGAGTGAAAGAGG + Intergenic
963698730 3:148597244-148597266 AGGGTTTTAAAGATTAAATGTGG - Intergenic
963910529 3:150813835-150813857 AGGTTTTTACAGAAAGCAGGGGG - Intergenic
964301480 3:155290545-155290567 AGTTTTTTCCAGAGGGAAGGGGG + Intergenic
965120585 3:164550134-164550156 AGATTTTAAAAGAGTGATTGGGG - Intergenic
966610041 3:181858947-181858969 AGGTATTTTCAGAGTGAGAGAGG - Intergenic
967466064 3:189807357-189807379 AGTTTTTTGTAGAGTAAATGAGG + Intronic
970281519 4:14461296-14461318 AAGTTTCTACAGAATGGATGGGG + Intergenic
971756198 4:30711567-30711589 AGGTGTCTATAGAGGGAATGTGG + Intergenic
971906320 4:32731316-32731338 TAGTGTTTACAGAATGAATGTGG - Intergenic
972943323 4:44223505-44223527 AAGTTTTTACTGATTGAATATGG - Intronic
973609432 4:52620526-52620548 AGGCTTTTACATAGCAAATGTGG + Intronic
975110091 4:70613693-70613715 TGGGTTTTTCAGAGTGAATGTGG + Intergenic
976926493 4:90504463-90504485 AGTTTTTTAGAGAGAGAATTTGG - Intronic
978426180 4:108585004-108585026 TGGTTTTTACACTGTGAAAGGGG - Intergenic
979121973 4:116914637-116914659 AGGTTTTTAAAGAAAAAATGAGG - Intergenic
979215540 4:118159465-118159487 TGTTTTTTACAGAGTGAGAGAGG + Intronic
980229230 4:130026559-130026581 TGGTTTATACAGTGTGAGTGTGG + Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
983088385 4:163474596-163474618 AGGCTTTTATAGGGTGAATTTGG - Intergenic
983875189 4:172867040-172867062 AGACTTTTAAAGACTGAATGAGG - Intronic
985081792 4:186273343-186273365 AGGTTTTTACAGTGTGTTGGAGG - Intronic
986265392 5:6186000-6186022 AGGTTTTGAAGGAGTGCATGGGG - Intergenic
986688177 5:10291940-10291962 AGGAATTTACAGTGGGAATGGGG + Intronic
988706319 5:33729276-33729298 AAGCTTTTATAGAGTGAATGTGG + Intronic
989069072 5:37491121-37491143 AGGTATCTACAGGGAGAATGTGG + Intronic
990019774 5:51111024-51111046 AGGTTTTCAGAGAATGAATTGGG - Intergenic
990126455 5:52524508-52524530 ATGTCTTTACAGAGTGTTTGTGG - Intergenic
990837616 5:60040008-60040030 CAGTTTTGATAGAGTGAATGGGG - Intronic
991064125 5:62407717-62407739 AGGCTTTTATAGGGTGAATGTGG + Intronic
992645984 5:78811354-78811376 AGGTTCTTAGGGAGAGAATGAGG - Intronic
994355589 5:98791072-98791094 AGGACCTTTCAGAGTGAATGGGG - Intronic
994716219 5:103324343-103324365 AGGTATTTACAGAGTGTTTTTGG - Intergenic
996797842 5:127369617-127369639 ATTTTTTTAAAGAGTGAATTAGG + Intronic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
996988996 5:129605243-129605265 GGGATTTTACAGAGTGAACCAGG - Intronic
998296863 5:140979022-140979044 AGGTTACTTCTGAGTGAATGAGG - Intronic
998747375 5:145276146-145276168 AGGTTATTGGAGAGTGAAAGAGG - Intergenic
1001404354 5:171465307-171465329 AAGTTTTAAAAAAGTGAATGTGG - Intergenic
1001631320 5:173177697-173177719 AGGTTCTTGCAGAGTGCATGTGG + Intergenic
1002313870 5:178330943-178330965 AGGATGTGACAGAGTGAAGGCGG - Intronic
1002508404 5:179696842-179696864 GTGTTTTTACAAATTGAATGTGG + Intronic
1003409852 6:5852461-5852483 AGCCTTTTACTGATTGAATGAGG + Intergenic
1003594322 6:7460911-7460933 AGGCTTTTACAGGGTGAACACGG + Intergenic
1003765073 6:9226754-9226776 TGGTTTTGACACAGTGAGTGTGG + Intergenic
1004961283 6:20791594-20791616 AGAGTTTTACAGAGAGAATGGGG + Intronic
1005668250 6:28079524-28079546 AGGTTTTTAAAGGAAGAATGGGG - Intergenic
1005979931 6:30829033-30829055 AGATTTTTACAGTGGGAATCTGG + Intergenic
1006388905 6:33747263-33747285 AGGTTCTTGCAGAGAGGATGGGG - Intergenic
1006402039 6:33823292-33823314 AGGTGTTTACAGATACAATGGGG - Intergenic
1008191694 6:48466424-48466446 AGGTTTTTAGAGAGCTAATGGGG - Intergenic
1008272111 6:49502283-49502305 AGGATTTTACCCATTGAATGGGG + Intronic
1009497342 6:64367641-64367663 ATCTTTTTACATTGTGAATGGGG + Intronic
1010168710 6:72948931-72948953 AGTGTTTTTCAGAGAGAATGGGG - Intronic
1010274445 6:73952895-73952917 AGGTTTTAAAAGAGAGTATGTGG + Intergenic
1011104060 6:83759013-83759035 AGGCTTTTGCTGAGAGAATGTGG + Intergenic
1012819691 6:104070259-104070281 AGGCTTTTACTGAATGGATGAGG - Intergenic
1012945470 6:105461203-105461225 AGGATTTTACTGAGTGATGGGGG - Intergenic
1014188572 6:118464744-118464766 CTGTTTTTCCAGAGTGATTGTGG - Exonic
1015030923 6:128594944-128594966 AGTTTTTGATAGAGGGAATGGGG - Intergenic
1015986347 6:138887813-138887835 AGATTTTTATAGAATGAATAGGG - Intronic
1017630659 6:156393300-156393322 AGTTCTTTACAGAGTGAAGGAGG - Intergenic
1017707540 6:157137713-157137735 AGGCTATTACAGAGTGAGTGAGG - Intronic
1018029649 6:159831810-159831832 ATGTCCTGACAGAGTGAATGTGG + Intergenic
1018524650 6:164695300-164695322 AGTGTTTTCCACAGTGAATGAGG - Intergenic
1018706294 6:166465712-166465734 AGGTTTGTGCACAGTGAAAGTGG - Intronic
1019508043 7:1403338-1403360 AGGCTTTTCTAGAGGGAATGAGG + Intergenic
1019925315 7:4187760-4187782 ACGTTTTTATGGTGTGAATGTGG + Intronic
1020614568 7:10442082-10442104 AGGTTTTCACAGAGTGGTTGTGG - Intergenic
1020990715 7:15192510-15192532 AGGATTTTACTGAGTGATGGAGG - Intergenic
1021769113 7:23980766-23980788 AGGTTTTTAATGGGTGATTGGGG - Intergenic
1023305592 7:38823077-38823099 AGGTTTCAACACAGTGAATTTGG - Intronic
1023662182 7:42481054-42481076 AGTTTTTTAAAGATTGAAGGTGG - Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1028541443 7:91946701-91946723 TGGTGTTTAGAGAGAGAATGTGG + Intronic
1029912809 7:104173287-104173309 AGGTTTTTAAAGGAAGAATGAGG - Intronic
1030697929 7:112606490-112606512 AAGATATTACAGTGTGAATGTGG + Intergenic
1031063750 7:117081654-117081676 ATGTTTTGCCAGAGTGAATGAGG + Intronic
1031219031 7:118940052-118940074 AGGTTTTTATAGAATGAACATGG - Intergenic
1031236112 7:119179850-119179872 AGGTCTTTCTAGAGGGAATGTGG + Intergenic
1031356631 7:120794815-120794837 AAGAATTTACAGAGTGACTGAGG - Intronic
1032137187 7:129290628-129290650 TGTTTTTTAAAAAGTGAATGTGG + Intronic
1036505721 8:9353681-9353703 AGGCTTTTTAAGAGTGAGTGTGG + Intergenic
1037204671 8:16301963-16301985 AGGTTCATACAGAGGGTATGTGG - Intronic
1038245649 8:25852482-25852504 AGGTTTTTACAATGTGAATGAGG + Intronic
1038839760 8:31172724-31172746 AGATTTTTACTTACTGAATGAGG + Intronic
1039635404 8:39159321-39159343 TGGTTTTTACAGATTGACTCTGG + Intronic
1039647623 8:39304823-39304845 AGGGCTTGACAGAGGGAATGTGG - Intergenic
1040028573 8:42803852-42803874 GAGTTTTTAAAGAGAGAATGAGG + Intergenic
1040963593 8:53061913-53061935 GGCTTTTTAAAGAGAGAATGAGG + Intergenic
1042751178 8:72159413-72159435 TGGTTTTTGCACAGTGAAGGTGG - Intergenic
1044806656 8:96015378-96015400 AGATTTATACCGAGTGAATGAGG - Intergenic
1046016259 8:108609029-108609051 AGGTTTTTACAGTGAATATGGGG - Intronic
1047265159 8:123300476-123300498 AGGTTTTTACAAAGTGATCATGG + Intergenic
1051502436 9:17792627-17792649 AGGTTTGGACAGAGGGAAGGAGG - Intronic
1053556317 9:39141225-39141247 CAGTTATTACAGGGTGAATGAGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1059280129 9:113125778-113125800 AGGCTTTTATAAGGTGAATGAGG - Intergenic
1061110885 9:128570130-128570152 TTGTTTTCCCAGAGTGAATGAGG + Intronic
1062471135 9:136705382-136705404 AGGCTTTTACAGGCTGAATGTGG - Intergenic
1188166019 X:26865357-26865379 AGTTTTTGACAGAGTGAATCTGG + Intergenic
1188170262 X:26915952-26915974 TGGTTTTTACAGAATGAAACAGG + Intergenic
1189940840 X:46119015-46119037 AGGCTTTTATAGGGTGAATGTGG - Intergenic
1192544318 X:72000745-72000767 GGGTTTTTATAAAGTGAAAGCGG - Intergenic
1193241832 X:79179584-79179606 AGGCTTTTATAGTTTGAATGTGG - Intergenic
1195436662 X:104852253-104852275 AGGTTTTAAAAGACAGAATGAGG + Intronic
1199260505 X:145768044-145768066 AGGCTTCTACAGAGTTGATGTGG + Intergenic
1200442906 Y:3232317-3232339 AAGTTTTTGTACAGTGAATGGGG + Intergenic