ID: 1066669317

View in Genome Browser
Species Human (GRCh38)
Location 10:37820312-37820334
Sequence CTGAAACAGAAGTGAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 7, 3: 24, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066669316_1066669317 11 Left 1066669316 10:37820278-37820300 CCAGATCTCATAGATGAGGGACT 0: 1
1: 0
2: 3
3: 15
4: 170
Right 1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG 0: 1
1: 1
2: 7
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066669317 Original CRISPR CTGAAACAGAAGTGAAGCAC AGG Intronic
901381435 1:8877478-8877500 CTGAAAGGCAAGTGAAGCAATGG + Intronic
905412905 1:37784194-37784216 AAAAAACAGAATTGAAGCACAGG - Intergenic
905444075 1:38013554-38013576 CTGAATCAGATATTAAGCACGGG - Intronic
906535132 1:46547318-46547340 CGGCTACAGAAGTGAACCACAGG - Intronic
906996044 1:50795424-50795446 CAGCAAAAGAAGTGCAGCACTGG + Intronic
907514469 1:54984699-54984721 GTGAAGCAGAAGTTAAGCACAGG + Intronic
908648151 1:66302148-66302170 CTGAAGCAGAAGTGACCCACTGG + Intronic
910010189 1:82452197-82452219 CTGAGACAGAAATGAAAAACAGG - Intergenic
910353328 1:86324900-86324922 CTGTAACACAAGAGAAGTACAGG + Intergenic
913088146 1:115458041-115458063 AAGAAACAGAAGAGAAGCACAGG + Intergenic
913122317 1:115753491-115753513 CTGAGACAGAAGCCAAGCACTGG + Intronic
914380197 1:147108801-147108823 CTGAAGGAGAAATGAAACACAGG + Intergenic
916373734 1:164128567-164128589 CTGAAACAACAGTAAAGAACAGG - Intergenic
916489612 1:165289934-165289956 CTGAAACAATAGTGAAGCACAGG + Intronic
918384192 1:183988662-183988684 CATAAAAAGAAGTGAAGTACTGG - Intronic
918425254 1:184402965-184402987 CTGAAAGATAAGGGAAGCAGGGG - Intronic
918954888 1:191194048-191194070 CTGAATAAGATGTGAAGCTCTGG + Intergenic
919243457 1:194945614-194945636 CTAACAAATAAGTGAAGCACAGG + Intergenic
919789965 1:201284481-201284503 CTGAGACAGGAGTGCAGCTCAGG + Intronic
920058763 1:203213360-203213382 CACAGGCAGAAGTGAAGCACAGG + Intronic
922454911 1:225766918-225766940 CTGACACAGAAGTGTAGCCCTGG - Intergenic
1065016590 10:21468096-21468118 GGGAGACAGAAGTGAAGGACAGG - Intergenic
1065177947 10:23096470-23096492 CTGAAATAGAACTGAAATACAGG - Intronic
1065887949 10:30095270-30095292 CTGAAAGAGAAGTGAAGAAATGG - Intronic
1066583027 10:36901299-36901321 CTGTAACAGAAAAGAAGTACAGG + Intergenic
1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG + Intronic
1066955331 10:42164204-42164226 CTGGAAAAAAATTGAAGCACTGG + Intergenic
1067180249 10:43979867-43979889 CTGAAATAGACGTGTAGCCCAGG - Intergenic
1068968660 10:62939488-62939510 CTGAACTACATGTGAAGCACTGG + Intergenic
1069682727 10:70296733-70296755 CTGAACCAGATGTGAAGGGCAGG - Intergenic
1072958484 10:99907836-99907858 CTGAGACAGAAGGAAAGCAGAGG + Intronic
1074374719 10:112930067-112930089 CTGAATCAGAAATGATGCAGAGG + Intergenic
1075021561 10:118956268-118956290 CTGAAGCAGGAGGGAAGAACAGG + Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1075559706 10:123459785-123459807 CTGAAACATAAATGAGGTACAGG - Intergenic
1076490333 10:130856988-130857010 CAGGAACAGAAGTGAAACTCAGG - Intergenic
1079519169 11:21304432-21304454 GTGACACAGAAGTGATGCAGTGG + Intronic
1079794313 11:24780227-24780249 CTGAAACTGAACTGAAACTCTGG + Intronic
1081153836 11:39664724-39664746 CTGAGACAGAAGAGAAGCAATGG - Intergenic
1081204003 11:40253574-40253596 TTTAAAGAGAAGTGCAGCACAGG - Intronic
1082190210 11:49233993-49234015 CTATTATAGAAGTGAAGCACAGG - Intergenic
1083537116 11:63479782-63479804 ATGAACAAGAAGTGAAGAACAGG + Intronic
1084974524 11:72789565-72789587 CTGGGACAGCAGTGAGGCACAGG + Intronic
1085228420 11:74943664-74943686 TTGAAAAAAAAGTGAAGCTCTGG - Intronic
1086151080 11:83611766-83611788 CTGATACTGAACTGAAGGACGGG + Intronic
1086395787 11:86413519-86413541 CTGATACAGAAGGGAAGTGCTGG - Intronic
1086675915 11:89606915-89606937 CTATTATAGAAGTGAAGCACAGG + Intergenic
1087393179 11:97565304-97565326 CTGAAACAGTACTGCAGTACTGG + Intergenic
1087546650 11:99592549-99592571 GTGAAACAGAGGTCAAGAACTGG + Intronic
1088017041 11:105073404-105073426 ATGGAAGAGAAGTGATGCACAGG - Intronic
1088019589 11:105103304-105103326 ATGGAAGAGAAGTGATGCACAGG - Intergenic
1088105281 11:106200105-106200127 CTTAGCCAGAAGTGAAGCACAGG - Intergenic
1088406636 11:109487766-109487788 TTGAAAGAGAAGTAAAGAACTGG - Intergenic
1088442914 11:109891660-109891682 CTGAACCAGAAGTCAAACATGGG - Intergenic
1089880112 11:121765513-121765535 CTGAAACAGAAGAAAAGCTTTGG - Intergenic
1091446033 12:544616-544638 CTGAAACTGAAATGATGCAGGGG - Intronic
1093030436 12:14283734-14283756 CTGAAAGAAAAGTGAAGGATGGG + Intergenic
1093218670 12:16392594-16392616 CTGGAACAAAAGTGAAGGACTGG - Intronic
1095142945 12:38689065-38689087 CTGACACAAAAGTAAAACACAGG + Intronic
1095477849 12:42604024-42604046 GTGAAACAGAGGTGAAGGATGGG - Intergenic
1095994794 12:48071995-48072017 CTGAAACAGACAGGAAGCACAGG - Intronic
1100044466 12:90362048-90362070 CCGAAACAGATGTCAAGCATTGG - Intergenic
1100878022 12:98983602-98983624 ATGAAACAGTAGTGAATCATGGG - Intronic
1100885385 12:99064333-99064355 GTAAAATAGAAGTGAAGCAATGG + Intronic
1101509643 12:105381124-105381146 CTGGAAGAGAAGGGGAGCACTGG - Intronic
1103241773 12:119419424-119419446 GTGAACCTGAAGTGATGCACTGG - Intronic
1107688983 13:42933092-42933114 CTGAAATAGAAAAGGAGCACTGG + Intronic
1108767747 13:53654030-53654052 TGGAATCAGAAGTGAAACACAGG - Intergenic
1109454036 13:62559839-62559861 CAAAAAAAGAAGTGAAGCATTGG + Intergenic
1110362253 13:74641073-74641095 ATGAAAAAAAAGTGAAACACTGG - Intergenic
1110434947 13:75468994-75469016 CTGAGACAGAAGTGAAAAAGTGG + Intronic
1111384851 13:87511878-87511900 TTGAAAAAGTAGTGTAGCACTGG + Intergenic
1111894045 13:94118853-94118875 CTGAAGCAGAAGTAAAGCACAGG - Intronic
1112284318 13:98090530-98090552 GGGAAACAGAAGAGAGGCACAGG + Intergenic
1112357330 13:98684716-98684738 CAGAAACAGATGTGAAGGTCAGG - Exonic
1112828948 13:103424984-103425006 CTGAGAAAGAACTGAAGCAGGGG + Intergenic
1112893392 13:104267233-104267255 CGGAAACAGAAGTGAAGATTGGG - Intergenic
1116605511 14:46988423-46988445 CTGAAACACCAGGGAAGCAAAGG + Intronic
1116677203 14:47920810-47920832 GGGAAACAGAAGTGAAGCAAAGG + Intergenic
1117233781 14:53750095-53750117 CTGTAACTGAAGTGGAGGACAGG + Intergenic
1117410703 14:55448304-55448326 CTGAAATAGAAGTGAAAAAAAGG - Intronic
1118362913 14:65070880-65070902 CTGAAACTGGAATGAAGAACAGG + Intronic
1118836516 14:69482196-69482218 CAATAAGAGAAGTGAAGCACAGG - Intergenic
1120626096 14:86828148-86828170 TTGTAACACAAGAGAAGCACAGG + Intergenic
1120695204 14:87637096-87637118 CTGAAACAGCAGTGTAGCTGGGG + Intergenic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1123842750 15:24265647-24265669 GTGAAAAAGAAGTGAAGGCCAGG - Intergenic
1123857789 15:24431673-24431695 ATGAAAAAGAAGTGAAGGCCAGG - Intergenic
1123862422 15:24482231-24482253 ATGAAAAAGAAGTGAAGGCCAGG - Intergenic
1126061593 15:44787831-44787853 CTGCAACAGAAGTAAATCAGAGG + Intergenic
1126670381 15:51110595-51110617 CTGATACAGAAGAGAAGGATGGG - Intergenic
1127407894 15:58671896-58671918 ATGTAACAGAAATAAAGCACTGG + Intronic
1127856457 15:62957653-62957675 ATGAAATAGAATTGATGCACAGG + Intergenic
1130611072 15:85361454-85361476 CAGAAATAGAAGGCAAGCACTGG - Intergenic
1131063431 15:89418239-89418261 CTGAAACAAAAGTAAACCTCTGG - Intergenic
1131274359 15:90968561-90968583 CTGAAGCATAGATGAAGCACTGG - Intronic
1132086110 15:98909616-98909638 CTCCCACAGAAGGGAAGCACAGG + Intronic
1133539170 16:6732078-6732100 CTGAAAGAGAAATGAAGGAAAGG - Intronic
1133620673 16:7523314-7523336 TTGAAACAGAAGAGAAGGAAGGG + Intronic
1134335369 16:13294515-13294537 ATGAAGCAGAATTGATGCACTGG - Intergenic
1135085713 16:19473042-19473064 CTCACACAAAAGTGCAGCACAGG + Intronic
1136958498 16:34814939-34814961 CTGAAAAAAAATTGAAGCATTGG - Intergenic
1140113657 16:72023655-72023677 TTGAAACAGAAGTTAGGCAGAGG + Intronic
1141217804 16:82041606-82041628 CTGGAGCAGAAGTCAAGCTCTGG - Intronic
1141509028 16:84500750-84500772 CTGAAACAGAGGGGCTGCACCGG + Intronic
1146581034 17:34039341-34039363 CTGAAACAAAAGTGAAGCAGAGG + Intronic
1147355537 17:39893085-39893107 CTGCAAAGGAAGTGAAGCAGTGG - Intergenic
1147627770 17:41910870-41910892 CTGACTCAGCAGTGACGCACAGG - Intronic
1147977398 17:44255569-44255591 CTGAAAAAGAAGGGAAGCTAAGG + Intronic
1150114675 17:62536316-62536338 CTGAAACAAAAGTGAAGCAGAGG - Exonic
1150714544 17:67560281-67560303 CTGAAATAGAATTGATCCACTGG - Intronic
1150759441 17:67947787-67947809 CTGAAAGAGAAGAGAATCAAAGG + Exonic
1151962873 17:77416471-77416493 CTGAAGCAGCAGTGAAGCCAGGG + Intronic
1152335152 17:79696528-79696550 CTGATACAGAAGGGAAGTGCTGG + Intergenic
1203160076 17_GL000205v2_random:41318-41340 CTGAAACAGAATTGTATCAGTGG + Intergenic
1154032991 18:10769672-10769694 AGGAAACAGAAGTGCAGTACAGG + Intronic
1156735242 18:40249491-40249513 CTGAAAAAGAAGTGTGGCAGTGG + Intergenic
1157155664 18:45263063-45263085 CTGAAACAGAAAACAAACACTGG - Intronic
1157567843 18:48691766-48691788 CTGAGACAGATCTGAAGCCCTGG + Intronic
1157740480 18:50088416-50088438 CTTAAATACAAGTGCAGCACTGG + Intronic
1157931108 18:51824455-51824477 TTGAAACAGAAGTTTAGAACTGG - Intergenic
1158736961 18:60093086-60093108 CTTAAACAGAAAAGAACCACAGG - Intergenic
1159232553 18:65628092-65628114 CTGAGAAAGAAGTACAGCACCGG + Intergenic
1164686374 19:30169145-30169167 CTGAGATAGATGTGAAGCAATGG + Intergenic
1165308829 19:35018703-35018725 CTGAACCAGGAGTGACGCTCAGG + Intronic
1165574393 19:36801551-36801573 CTGCATCAGAAGAGACGCACAGG - Intergenic
1168271295 19:55251201-55251223 GTGACACAGCAATGAAGCACTGG + Intronic
928676064 2:33653021-33653043 CTGGCACAGAAGTGAGGCAAAGG + Intergenic
929731788 2:44502457-44502479 GTGAAACTGAAATAAAGCACTGG - Intronic
929984171 2:46709987-46710009 CTGAACCAGAATTCAAGCATGGG - Intronic
930543690 2:52740516-52740538 CTGCAAAAGAAGAGAAGCACTGG + Intergenic
931869646 2:66444670-66444692 CTGAACCAGACGTGAGGCCCGGG - Intronic
933530178 2:83499099-83499121 GAGATAAAGAAGTGAAGCACAGG + Intergenic
934520143 2:95014962-95014984 CTGGTACAGAAGTGAAACCCTGG + Intergenic
935407572 2:102725075-102725097 CTGAAAGAGAAGAGAAGCTTAGG - Intronic
936273303 2:111068956-111068978 CTGAAATACAAGTGGATCACTGG + Intronic
937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG + Intergenic
938319762 2:130355366-130355388 GGGAAACAGAACTGAGGCACTGG - Intergenic
939423230 2:142000956-142000978 GTGAAAAATAAGTGAATCACAGG + Intronic
940360414 2:152790758-152790780 CTGATACGGAAGGGAAGCTCTGG + Intergenic
940622106 2:156125158-156125180 CTGAAAGGGAAGTGGGGCACCGG - Intergenic
941199159 2:162488067-162488089 CAGGAACAGAAAAGAAGCACAGG - Intronic
941802310 2:169673353-169673375 CTCAAACACAAGTGATTCACTGG + Intronic
943716391 2:191156914-191156936 CTGAAACAGAAGTAAATAAAAGG - Intergenic
944689165 2:202144256-202144278 TTGAAACAGAAGTGAAGAAAGGG - Intronic
945183352 2:207114329-207114351 CTGCAACAGAAGTTCAGTACAGG + Intronic
945541514 2:211092965-211092987 CAGAAACAGAATTGGAGCAGAGG + Intergenic
945712518 2:213316500-213316522 CTGAATCAGAAGTAAACCATAGG - Intronic
1169678800 20:8186067-8186089 CTGAAACAAAAGCGAAGTATAGG - Intronic
1171040017 20:21754315-21754337 CTGACAAAGAAGAGAAGCTCTGG - Intergenic
1171060358 20:21951514-21951536 CTGCAACAAACATGAAGCACAGG + Intergenic
1171320838 20:24242646-24242668 CTGACACAGAGGTGAAGAAGTGG - Intergenic
1173612855 20:44383411-44383433 CTGAACCAGAATTTAAGCCCAGG + Intronic
1174004170 20:47397059-47397081 ATGAGACAAAAGTGAATCACAGG - Intergenic
1174308499 20:49632065-49632087 CAGAAGCAGAAGAGAAGCAGGGG - Intergenic
1175070451 20:56329028-56329050 CTGCAAAAGAAGTCATGCACTGG - Intergenic
1175322458 20:58098908-58098930 CTGATTCAGAAGTGAAGCAAAGG - Intergenic
1177411734 21:20738638-20738660 CTGATACAGAACTGAAGCAATGG + Intergenic
1177911313 21:27036212-27036234 CTGAAAAAGCACTGAAGCAAAGG + Intergenic
1179083032 21:38191248-38191270 CAGACACAGGAGTCAAGCACAGG - Intronic
1179365240 21:40752931-40752953 ATGAAATAGATGTGAAGCAATGG + Intronic
1179943879 21:44657625-44657647 ATGAAACAAAAGTGAAACAACGG + Intronic
1180904362 22:19398268-19398290 CTGTAAAAGGAGTGAGGCACTGG - Intronic
1181139977 22:20797278-20797300 CTGAGCCAGAACTGAAGAACTGG + Intronic
1182478827 22:30593092-30593114 CAGAGACAGACGTTAAGCACTGG + Intronic
950925954 3:16742198-16742220 GTGAAGCAGAAGTAAGGCACTGG - Intergenic
950987023 3:17384161-17384183 CTGAAAAAGGAGTGAGGCAAGGG + Intronic
951371869 3:21859268-21859290 CTGAAGCAGAAGTGAATCTGCGG - Intronic
952060119 3:29497817-29497839 CAGAGACAGAGGTAAAGCACTGG - Intronic
952526687 3:34218060-34218082 CTGCAACAGAAGTAAATCAGAGG - Intergenic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
955077326 3:55625841-55625863 CTTAAACCGAAGTGAAATACAGG + Intronic
955779240 3:62465841-62465863 GGGAAACAGAAGTTTAGCACTGG + Intronic
956813794 3:72889493-72889515 CTGAGACAGAAGGGAAACAAAGG - Intronic
956968328 3:74489972-74489994 ATGGAACAGAAGAGAAGCAAAGG - Intronic
957034793 3:75283783-75283805 CTCAAAGAGAAGTGTAGCCCTGG + Intergenic
957261776 3:77910890-77910912 ATGAAAGAGAAATGAAGCAGGGG + Intergenic
957690432 3:83558827-83558849 CTGAAGCAGAAGTGATAAACAGG - Intergenic
957976908 3:87457727-87457749 CTGGAACAGAAATGAAGAAGGGG - Intergenic
958667626 3:97160816-97160838 CTGAAACAGCCCTGAAACACTGG - Intronic
958855260 3:99376978-99377000 CCAAAGCAGAAGTGAAGTACAGG + Intergenic
959278901 3:104311736-104311758 CTGAAGTAGAAGAGAAGTACAGG - Intergenic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
961078668 3:124005370-124005392 CTCAAACAGAAGTACAGCCCTGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961593882 3:128001372-128001394 CAGAAACTGAACTGAAGCACTGG + Intergenic
962843006 3:139252415-139252437 CTGGATCAGTAGTGAAGCCCTGG + Intronic
963778564 3:149464451-149464473 CTGAAACAGCAGTCAATCATTGG + Intergenic
964870108 3:161304248-161304270 TTGACAAAGAAGTGAAGCAATGG + Intergenic
966286777 3:178306260-178306282 CTGACACAACAGTGAAGAACAGG + Intergenic
966304357 3:178513928-178513950 CTGAGACAGAAGGGAAAGACAGG - Intronic
966778713 3:183565078-183565100 CTGAAACAGAAGCAGAGCAGTGG + Intergenic
967552335 3:190811067-190811089 CTGATACAGACAGGAAGCACAGG - Intergenic
969942276 4:10745988-10746010 CAGAAACAAAACTGAGGCACAGG + Intergenic
970101330 4:12525669-12525691 CTGAAACAGATGGGAAGAATGGG + Intergenic
971224531 4:24738629-24738651 CTGAAGCAGAAGGGATGCAAAGG + Intergenic
971301238 4:25443987-25444009 GTGAGACAGAATTGAAACACAGG + Intergenic
971782959 4:31061933-31061955 CTGGAGCAGAAGAGAAGCAGAGG - Intronic
972696596 4:41452472-41452494 CTGAAACTGAAATATAGCACTGG - Intronic
972917586 4:43900199-43900221 TTGAAACAGATGTGAAGTAGAGG - Intergenic
975626729 4:76357476-76357498 CCGAAACAAAAGTGAAGAAATGG - Exonic
975803689 4:78090112-78090134 CTGGAACAGCAAGGAAGCACAGG - Intronic
977849063 4:101802194-101802216 CTGATACAGAAGGGAAGTACTGG - Intronic
978063912 4:104372440-104372462 CTGAAACAGAAGTGTAAAAGTGG - Intergenic
978547521 4:109888192-109888214 CTGAAAGACAAGTGAAAAACAGG - Intergenic
979993634 4:127405255-127405277 ATGAACCAGAGGTGAAGCAATGG - Intergenic
981819392 4:148868315-148868337 CTGAAACAGCAAGGAAGCAGAGG - Intergenic
982191044 4:152855577-152855599 CTGAAAAACAAGAGAAGCATGGG - Intronic
985254920 4:188060513-188060535 CTGCAACAGTAGTGGAGCAGAGG + Intergenic
985856056 5:2428421-2428443 TAGAAACAGGACTGAAGCACTGG + Intergenic
989166401 5:38437233-38437255 AAGAAACAAAAGTGAAACACAGG - Intronic
990506037 5:56446456-56446478 CTGAAATACAAGCAAAGCACAGG - Intergenic
991316027 5:65307869-65307891 CTTAAAAAGAAATGAAGTACTGG - Intronic
991562840 5:67972656-67972678 CTGAAACAGGAGGGAAACAGAGG + Intergenic
992010345 5:72519351-72519373 CTGAAATGGAAGTGAAAGACTGG + Intergenic
993099375 5:83518510-83518532 CTGAAACACAAATGTAGAACAGG - Intronic
993436230 5:87899165-87899187 TTGGAACAATAGTGAAGCACTGG + Intergenic
994498579 5:100544255-100544277 AAGAAACTGAAGTGAATCACTGG + Intronic
996478798 5:123949955-123949977 CTGGAAGAAAAGTGAAGGACAGG - Intergenic
996932485 5:128906662-128906684 CTGACATAGATGTGAAGCTCTGG + Intronic
997039396 5:130233954-130233976 CTGGAACAGATGTGCAGCACTGG + Intergenic
1000104872 5:158049780-158049802 CTGACTCAGAAATGAAGCCCAGG + Intergenic
1000926737 5:167203268-167203290 GTGTAACAGAAGTGATGCAGTGG - Intergenic
1001787684 5:174427616-174427638 CTTAAAAAGAAGAGAAGAACAGG - Intergenic
1003292033 6:4788136-4788158 CTGCTACAGAAGTGAGCCACTGG - Intronic
1003474975 6:6472930-6472952 GTGAAAAAGAAGCCAAGCACTGG - Intergenic
1006874463 6:37283259-37283281 CTGAAACAGGAGTGAAGCACAGG - Intronic
1008432541 6:51436244-51436266 CTGAAAAAGAAGTGAGGCTTAGG - Intergenic
1008724195 6:54396044-54396066 CTGGAACTGAAGTAAAGCAATGG - Intergenic
1010142389 6:72626218-72626240 AAGAAAAAGAAGTGAAGCCCGGG + Intronic
1010771462 6:79836581-79836603 TTGACACAGGAGGGAAGCACAGG + Intergenic
1012155585 6:95815719-95815741 CTGAAACAAAACTGAAGTATTGG + Intergenic
1012176687 6:96095566-96095588 CTGAAAGAAAAGTGAAGAATGGG - Intronic
1012182384 6:96171065-96171087 AAGAAACAGAAGTGCAGAACAGG + Intronic
1013479030 6:110536670-110536692 CAGAAACAGAAGGAAAGCAAAGG + Intergenic
1013721776 6:113039107-113039129 CAAAAACAGAAGTGAAGCCCAGG + Intergenic
1014537916 6:122638563-122638585 CTGAAACAAAAGGGCAACACAGG - Intronic
1017045847 6:150346497-150346519 CTGAATCTGAAGTTAAGCTCTGG + Intergenic
1017081588 6:150674565-150674587 TTGAAACAAAAGTGAAACTCAGG - Intronic
1017591431 6:155982070-155982092 AAGAAACAGAACTGAAGGACGGG + Intergenic
1018434342 6:163747588-163747610 CTGAGGCAAAACTGAAGCACAGG - Intergenic
1018660618 6:166083135-166083157 CTGAAAAAGAAATCAAGCATGGG - Intergenic
1020962139 7:14818605-14818627 TGGAAACAGAAATGAAGCAATGG + Intronic
1022846910 7:34219499-34219521 GTGAAGCAGTAGTGAAACACGGG - Intergenic
1022958618 7:35403808-35403830 CTGAAGCAGCAATTAAGCACAGG + Intergenic
1023868645 7:44251203-44251225 CTGAGACAGAGGTAAAGGACAGG - Intronic
1027989839 7:85343783-85343805 GTGAACCAGAAGTGTAGCAGAGG - Intergenic
1028130472 7:87166245-87166267 TTGAAAGAGAAGGGAAGCCCGGG - Intronic
1028944203 7:96558267-96558289 ATGAAACAGAAAAGAAGCAAAGG + Intronic
1029679205 7:102096377-102096399 ATGAAGCAGAGGTGAAGCAGAGG - Intronic
1030186565 7:106768202-106768224 GTGAAACAGAAGTGAGGAATAGG - Intergenic
1031119250 7:117702562-117702584 CTAAAACAAAGGTGAAACACAGG - Intronic
1031610955 7:123826798-123826820 CTGAAACAGAATGGTAGCAAGGG + Intergenic
1032044384 7:128591996-128592018 CTGAAACAAAAGTGAAGCAGAGG - Intergenic
1033768975 7:144527168-144527190 CTGAGACAGAGTTGAAGCTCTGG - Intronic
1034562190 7:151888111-151888133 CTGGAAAAGATGTGAAGCAGTGG + Intergenic
1037324582 8:17675520-17675542 ATGGATCAGCAGTGAAGCACTGG - Intronic
1039421054 8:37441141-37441163 CTGCTACAGTAGTGCAGCACTGG + Intergenic
1040935626 8:52778826-52778848 GTGAAACAGATGGGAAGCAGAGG + Intergenic
1041626489 8:60034713-60034735 CTGAAACACAAGTGGAGGGCTGG - Intergenic
1041801517 8:61805530-61805552 CTGATACAGAAGTACAGTACTGG - Intergenic
1041982730 8:63881674-63881696 GAGAAACAGAACAGAAGCACAGG + Intergenic
1042880599 8:73484456-73484478 CTGGAATAGAAATGAAGCCCTGG + Intronic
1043479021 8:80633999-80634021 CTGTATCAGAGGTGAAGCAGTGG + Exonic
1043853942 8:85244186-85244208 CTGCAACATATCTGAAGCACTGG - Intronic
1044258066 8:90089411-90089433 TAGAAACAGAAGTGAATCAGTGG - Intronic
1045246300 8:100444378-100444400 CTCAAAGAGAAGCGAAGCAAAGG - Intergenic
1046508022 8:115161258-115161280 CTGGAAGAAAACTGAAGCACTGG + Intergenic
1046524199 8:115363252-115363274 CTGAAACACAAGTGGAGAAGTGG + Intergenic
1047343953 8:124009448-124009470 CTGCAACATCAGTGCAGCACCGG - Intronic
1048207614 8:132427789-132427811 CTGAAACAGCAGCTGAGCACAGG + Intronic
1048625768 8:136183457-136183479 GTGAAACAGAAGCAAAGCTCTGG - Intergenic
1051191019 9:14513332-14513354 ATGAAACAGAAATGAAGGCCGGG + Intergenic
1051359941 9:16272977-16272999 CCGAAACAGAAGTGTGGCCCAGG - Intronic
1052118810 9:24682733-24682755 CTGAAATAGAAGTGCAATACAGG - Intergenic
1053463826 9:38290541-38290563 CTGAAACAGCAGAGAGGCAGAGG - Intergenic
1054803026 9:69371106-69371128 CTGGAATATAAGTGAAACACAGG - Intronic
1055778830 9:79796742-79796764 CAGAAGCAGAAGTGAAGAGCTGG - Intergenic
1055916076 9:81401553-81401575 CTAAAACAGAAATGAGCCACGGG + Intergenic
1057450141 9:95151126-95151148 CAGGAAGAGAAGTAAAGCACGGG - Intronic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1060518724 9:124281956-124281978 CAGACACAGAAGTGGAGCCCGGG + Intronic
1062204393 9:135327907-135327929 TGGAAAAAGGAGTGAAGCACTGG + Intergenic
1186772403 X:12830935-12830957 GTGAGACAGATGTGAAGAACTGG + Intergenic
1188251696 X:27903810-27903832 CTCAAACAGAAGTCAAGCACTGG - Intergenic
1188859104 X:35235546-35235568 CTGATAGAGAAAAGAAGCACAGG - Intergenic
1189192073 X:39118930-39118952 CTGATGCAGAAGTGGAGCTCTGG + Intergenic
1189570321 X:42288524-42288546 GAGAGAGAGAAGTGAAGCACAGG + Intergenic
1189684511 X:43549984-43550006 CTCCAACAGAAGTGAGGCCCAGG + Intergenic
1189858976 X:45252704-45252726 CTGAAGCACAAGAGAAGCACTGG - Intergenic
1191042509 X:56099351-56099373 GAGAAACAGAAGTGAAGGAATGG - Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1192268919 X:69560161-69560183 CTTAAAAAGAAATGAAGTACTGG + Intergenic
1192326885 X:70140432-70140454 CTGAAAAAGAAGAGAGGCAGAGG + Intronic
1193379325 X:80800722-80800744 TTGAAAGAGAAGTGAAAAACCGG + Intronic
1194483150 X:94452283-94452305 CTGATACAGCAGTGAAGAATGGG + Intergenic
1195515134 X:105765316-105765338 GTGAAACAGAAGGGAAGGAAAGG - Intronic
1195814032 X:108866208-108866230 TAGAAAAAGAAGTGAAGCAGAGG + Intergenic
1195946528 X:110219537-110219559 CTAAAACATAAGTGAAGATCAGG + Intronic
1197930077 X:131685715-131685737 CTGAAACAGTTGTGAAGCACTGG + Intergenic
1199315119 X:146367755-146367777 CTGAGTCAGAATTCAAGCACAGG - Intergenic
1200577623 Y:4909312-4909334 GTGAAATAGAAGAGATGCACAGG - Intergenic