ID: 1066672201

View in Genome Browser
Species Human (GRCh38)
Location 10:37852311-37852333
Sequence CTGTTGACACATATACAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066672198_1066672201 12 Left 1066672198 10:37852276-37852298 CCATGGACCACTACTTAATAACA 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1066672201 10:37852311-37852333 CTGTTGACACATATACAACCCGG No data
1066672200_1066672201 5 Left 1066672200 10:37852283-37852305 CCACTACTTAATAACAAAAAGGA 0: 1
1: 0
2: 2
3: 36
4: 385
Right 1066672201 10:37852311-37852333 CTGTTGACACATATACAACCCGG No data
1066672197_1066672201 17 Left 1066672197 10:37852271-37852293 CCATACCATGGACCACTACTTAA 0: 1
1: 0
2: 6
3: 43
4: 314
Right 1066672201 10:37852311-37852333 CTGTTGACACATATACAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066672201 Original CRISPR CTGTTGACACATATACAACC CGG Intronic
No off target data available for this crispr