ID: 1066673842

View in Genome Browser
Species Human (GRCh38)
Location 10:37867245-37867267
Sequence TTACATGATCACATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066673842_1066673845 -1 Left 1066673842 10:37867245-37867267 CCAAGCTCCATGTGATCATGTAA No data
Right 1066673845 10:37867267-37867289 ACTGTCACCAATATACACGTGGG No data
1066673842_1066673847 12 Left 1066673842 10:37867245-37867267 CCAAGCTCCATGTGATCATGTAA No data
Right 1066673847 10:37867280-37867302 TACACGTGGGTGCATCTTGATGG No data
1066673842_1066673844 -2 Left 1066673842 10:37867245-37867267 CCAAGCTCCATGTGATCATGTAA No data
Right 1066673844 10:37867266-37867288 AACTGTCACCAATATACACGTGG No data
1066673842_1066673848 13 Left 1066673842 10:37867245-37867267 CCAAGCTCCATGTGATCATGTAA No data
Right 1066673848 10:37867281-37867303 ACACGTGGGTGCATCTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066673842 Original CRISPR TTACATGATCACATGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr