ID: 1066676203

View in Genome Browser
Species Human (GRCh38)
Location 10:37890015-37890037
Sequence CAGGCCCACCTCCAGCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066676194_1066676203 0 Left 1066676194 10:37889992-37890014 CCCATGATGCAATCACCTCCCAC 0: 29
1: 2449
2: 8354
3: 11987
4: 11040
Right 1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG No data
1066676195_1066676203 -1 Left 1066676195 10:37889993-37890015 CCATGATGCAATCACCTCCCACC 0: 25
1: 2452
2: 6994
3: 10735
4: 11157
Right 1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG No data
1066676191_1066676203 20 Left 1066676191 10:37889972-37889994 CCAAAGGGGGGAAATCAGCCCCC No data
Right 1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG No data
1066676192_1066676203 2 Left 1066676192 10:37889990-37890012 CCCCCATGATGCAATCACCTCCC 0: 35
1: 2276
2: 8134
3: 11831
4: 11561
Right 1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG No data
1066676193_1066676203 1 Left 1066676193 10:37889991-37890013 CCCCATGATGCAATCACCTCCCA 0: 37
1: 2562
2: 8529
3: 12615
4: 12737
Right 1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066676203 Original CRISPR CAGGCCCACCTCCAGCATTG GGG Intergenic
No off target data available for this crispr