ID: 1066684959

View in Genome Browser
Species Human (GRCh38)
Location 10:37972514-37972536
Sequence TAGGCCCAGCCCAAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066684959_1066684961 -5 Left 1066684959 10:37972514-37972536 CCTCAAAACTTGGGCTGGGCCTA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1066684961 10:37972532-37972554 GCCTAAGGTAAAATTTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066684959 Original CRISPR TAGGCCCAGCCCAAGTTTTG AGG (reversed) Intronic
900581521 1:3412127-3412149 GAGGGCCAGCCCAAGTTTGGGGG + Exonic
902242956 1:15100927-15100949 TGGGCCAAGCCCAGGCTTTGTGG + Intronic
903694608 1:25197597-25197619 TGGGCCCAGCCATAGTTTTGGGG - Intergenic
903888566 1:26555261-26555283 AAGCCCCAGCCCCAGTTTGGGGG + Intronic
906504411 1:46367535-46367557 CAGGCTAAGCCCCAGTTTTGAGG - Intergenic
907026397 1:51124426-51124448 TAGGCTAAACCCCAGTTTTGAGG - Intronic
907998778 1:59659496-59659518 CAAGCCGAGCCCAACTTTTGTGG - Intronic
911071621 1:93836256-93836278 TAGGCTCTATCCAAGTTTTGGGG - Intronic
915035712 1:152922339-152922361 TATTCCCATCCCAAGTCTTGAGG + Intergenic
915359518 1:155277701-155277723 TAGGCTCAGGCCCAGATTTGGGG - Exonic
915745895 1:158157557-158157579 CAGGCTGAGCCCCAGTTTTGAGG - Intergenic
918533234 1:185546393-185546415 TAGGCCCAGCCCACATTTAAAGG + Intergenic
923102552 1:230827872-230827894 TTGGCCCACCCCAACCTTTGGGG - Intergenic
924848211 1:247794457-247794479 TGGGCTCAGCCCCAATTTTGGGG + Intergenic
1063933734 10:11055735-11055757 TAGGCCCAGTGCAAGTGCTGTGG + Intronic
1066684959 10:37972514-37972536 TAGGCCCAGCCCAAGTTTTGAGG - Intronic
1070230022 10:74555838-74555860 TAGGACCAACTCAAGTTCTGAGG - Intronic
1070280842 10:75047145-75047167 GAGGCCCACCACAAGTTTTCAGG + Intronic
1071768732 10:88700350-88700372 TAGCCCCAGCCTGAGTTTAGGGG + Intergenic
1073120458 10:101119559-101119581 TAGGTCTAGCCCCAGTTTTAAGG + Intronic
1075605003 10:123798419-123798441 GAGGACCAGGCAAAGTTTTGGGG + Intronic
1075611830 10:123860749-123860771 TAGCTCCAGCTCAAGCTTTGCGG + Intronic
1075861501 10:125680789-125680811 AAGGCCCAAGCCAAGCTTTGGGG + Intronic
1075910715 10:126123501-126123523 CAGGCTCAGGCCAAGTTCTGGGG + Intronic
1076601554 10:131660126-131660148 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
1076938987 10:133588389-133588411 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
1077476615 11:2793326-2793348 TGTGCCCAGCCTCAGTTTTGAGG - Intronic
1077983083 11:7321541-7321563 TGGGCTAAGCCCCAGTTTTGGGG - Intronic
1080776300 11:35389901-35389923 TGGGCCCAGCCAAGGTTTTGGGG + Intronic
1081573266 11:44304307-44304329 TAGGCCCAGGCAACGGTTTGGGG - Intronic
1082764186 11:57153973-57153995 TCAGCCCAGTCCAAGTTTAGAGG - Intergenic
1083552254 11:63598755-63598777 TAGGCCCAGGCCAGGTGTTGGGG - Intronic
1083915611 11:65741551-65741573 CAAGCTCAGCCCCAGTTTTGGGG - Intergenic
1084025342 11:66444907-66444929 TAGGTCGAACCCCAGTTTTGGGG - Intronic
1089565135 11:119367239-119367261 CAGGCCAAGCCCAGGTTCTGAGG - Intronic
1092702240 12:11245071-11245093 TATGCCCATTCCAAGTTTGGGGG - Intergenic
1094852276 12:34387614-34387636 GAGGGCCAGCCCAAGTTTGCAGG - Intergenic
1096790436 12:54041259-54041281 AGGGCCCAGCCCAAGTGTTCAGG - Intronic
1097214973 12:57403688-57403710 TAGTCCCAGCTCAACTTGTGAGG + Intronic
1099026835 12:77475043-77475065 TAGGGCGGGTCCAAGTTTTGTGG - Intergenic
1099116432 12:78631322-78631344 TAGAAACAGCCCAAGTTTGGGGG + Intergenic
1101796022 12:107975121-107975143 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
1102448965 12:113026321-113026343 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
1104621157 12:130313761-130313783 CAGGCTAAGCCCCAGTTTTGGGG + Intergenic
1105300547 13:19130364-19130386 CACACCCAGCCCAAGTTTTAGGG + Intergenic
1110143634 13:72162598-72162620 TAGACCTAGCCCAAATTTTCTGG - Intergenic
1112022100 13:95380507-95380529 TAGGCTAAGCCCCAGTTTTGGGG - Intergenic
1115310206 14:31971811-31971833 TAGGCCCACCCAAATTATTGAGG + Intergenic
1115850811 14:37588515-37588537 CAGGCCCAGCCCCTGCTTTGTGG - Intergenic
1117762615 14:59046875-59046897 TACGCCCAGCACAAGCTGTGAGG + Intergenic
1117910914 14:60637667-60637689 GAGGCCCAGCCCAGCCTTTGCGG - Intergenic
1118010525 14:61606179-61606201 AATGCCCACCCCAAGTTTTTAGG + Intronic
1119508117 14:75190331-75190353 TGCGCCCAGCCTAATTTTTGTGG - Intergenic
1121276120 14:92669022-92669044 AAGACCCAGCCCATGTTTTTAGG + Intronic
1124610286 15:31203376-31203398 CATGCCCAGCCCATATTTTGGGG - Intergenic
1125906464 15:43397501-43397523 GATGCCCAGGCCATGTTTTGGGG + Intronic
1128749745 15:70140462-70140484 TAGGCCCAGCCCAAGAGCAGAGG + Intergenic
1129909196 15:79212244-79212266 TTGGCCAAGCCCACCTTTTGGGG + Intergenic
1130065236 15:80597373-80597395 TAGGCCAAGCCCATATTTTCTGG - Exonic
1132181678 15:99758304-99758326 TATGCCCCTCCCAAGTTTTCAGG + Intergenic
1133724342 16:8523424-8523446 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
1135147861 16:19978742-19978764 TAGGCCTACCCAAAGTATTGGGG + Intergenic
1137444219 16:48522123-48522145 AAGCCCCAGCCCAGGCTTTGGGG + Intergenic
1139582849 16:67883617-67883639 TGGACCCAGCCCAGGTTTTTGGG + Exonic
1140327940 16:74023910-74023932 GAGGCAGAGCCCATGTTTTGGGG + Intergenic
1140339839 16:74146712-74146734 TAGGCTAAGCCCCAGTTTTGGGG + Intergenic
1143902162 17:10182552-10182574 CAGGCTCAGCCCCAATTTTGGGG + Intronic
1146637766 17:34518861-34518883 CAGGCTCAGCCCAAGTTTGGGGG - Intergenic
1146722088 17:35130676-35130698 TAGACCCAGCCCAGATTTGGAGG - Exonic
1147371282 17:39994791-39994813 TATGCCCAGCACAGGTTTTCAGG + Intronic
1153437545 18:5083880-5083902 GAGGCCCAGCTTAAGTTTTGTGG - Intergenic
1155680907 18:28484175-28484197 TATGCTAAGCCCTAGTTTTGGGG + Intergenic
1155895343 18:31318084-31318106 TGAGACCAGCCCAAGTTTTTAGG + Exonic
1156055178 18:32993584-32993606 TGGGCCAAGCCCCAGTTTTGGGG + Intronic
1159860705 18:73645996-73646018 TAGGTCCAACTCAATTTTTGGGG - Intergenic
1161152133 19:2714992-2715014 CTGGGCCAGCCCAAGTTTTGGGG + Exonic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
1165147012 19:33737334-33737356 TGGGCTGAGCCCCAGTTTTGGGG + Intronic
928141314 2:28731759-28731781 TGGGCCCAGCACACATTTTGAGG - Intergenic
929673487 2:43899516-43899538 TATGCCAAGCCGAAGTATTGGGG + Exonic
930166739 2:48210553-48210575 ATGGCTCAGCCCAAGGTTTGGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
940987797 2:160065738-160065760 GAGGCCCATCTCAAATTTTGGGG - Intergenic
946058868 2:216924523-216924545 CAGGCTAAGCCCCAGTTTTGGGG + Intergenic
948022361 2:234745481-234745503 CAGGACCATCCCAAGCTTTGTGG - Intergenic
948674460 2:239588850-239588872 TAGGCCCAGCCCAGGCTGCGAGG - Intergenic
1172442928 20:34978434-34978456 TAACCCCAGCACAAGTTTTGTGG - Intronic
1172803873 20:37597633-37597655 TAGGCTAAGCCCCAATTTTGGGG + Intergenic
1174529576 20:51200220-51200242 TATTCCCAGCCAAAGTTTAGTGG + Intergenic
1178501384 21:33128359-33128381 TATGCCCAGCTCTAGTTTGGGGG + Intergenic
1181593842 22:23901358-23901380 CAGGCTGAGCCCCAGTTTTGGGG - Intergenic
1181909982 22:26230981-26231003 TGGGCTAAGCCCCAGTTTTGGGG - Intronic
1182111066 22:27724069-27724091 CAGGCTAAGCCCAAATTTTGGGG - Intergenic
950138902 3:10601777-10601799 TGGGCCCTGCCCAAGTTCTAAGG - Intronic
950402715 3:12782369-12782391 CAGGCTGAGCCCCAGTTTTGGGG - Intergenic
953873103 3:46644789-46644811 CAGGCTAAGCCCCAGTTTTGGGG - Intergenic
954301535 3:49703134-49703156 GAGGCCCAGCCCCAGTCCTGTGG - Intronic
954803581 3:53201889-53201911 GAGGCTAAGCCCCAGTTTTGAGG + Intergenic
957950608 3:87121178-87121200 GAGGCGCAGCCCAAGCTTTATGG + Intergenic
964641819 3:158916563-158916585 TAGGCTAAGCCCCAGTTTTGAGG - Intergenic
965083907 3:164069558-164069580 TAGGCCAAGCGCATGTTTTGAGG + Intergenic
971317928 4:25582909-25582931 TAGGCCCATCACAAGCTGTGTGG - Intergenic
971826537 4:31630751-31630773 TGTGCCCAGGCCATGTTTTGTGG + Intergenic
971992426 4:33916432-33916454 TAGGCTAAGCCCCAGTTTGGGGG + Intergenic
972330820 4:38063208-38063230 TAGTCCCAGCCCTGATTTTGAGG - Intronic
972891426 4:43560709-43560731 CAGGCTGAGCCCCAGTTTTGGGG + Intergenic
977096230 4:92748562-92748584 TAGGCTCTGCACAAGTCTTGAGG + Intronic
979799232 4:124887191-124887213 TAGTTCCAGCCCAAGTTCTAAGG + Intergenic
986234326 5:5893289-5893311 TGGAACCAGCCCAAGTTTGGGGG + Intergenic
989432797 5:41375203-41375225 TAGGCCCAGCACAAAATCTGTGG + Intronic
990940288 5:61195950-61195972 TAGGCACAGCCAAAGATTTCAGG - Intergenic
995199814 5:109413397-109413419 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
997372585 5:133371260-133371282 TAAGCTCTGCCCATGTTTTGGGG + Intronic
1001923872 5:175622101-175622123 TTGGGCCAGCCCAAGCTCTGGGG - Intergenic
1002025306 5:176392732-176392754 CAGGCCCAGCCCATGCTCTGTGG + Exonic
1002133322 5:177094301-177094323 TACTCCCAGCCCAAGGATTGTGG + Intronic
1003518626 6:6838457-6838479 TAGACCCAGCCTAACTTTTCTGG - Intergenic
1004214780 6:13692168-13692190 TAGGCCCAGCCCATTGTTTTTGG - Intronic
1006461773 6:34163485-34163507 TTGGCCAAGGCCAAGCTTTGTGG - Intergenic
1012665953 6:101970289-101970311 TGGGCCAAGCCCAAATTTTGGGG - Intronic
1012772379 6:103455177-103455199 TAGACCAAGCCCCTGTTTTGGGG + Intergenic
1016892541 6:149021050-149021072 GAGGCCCTGCCTAAGTATTGTGG - Intronic
1017158390 6:151342220-151342242 ATGGCGCAGCCCAAGTGTTGAGG - Intronic
1017822752 6:158060936-158060958 TTGGCCCAGACCAAGGTTGGTGG + Intronic
1018623334 6:165752327-165752349 CAGGCTAAGCCCCAGTTTTGGGG + Intronic
1022507117 7:30914180-30914202 CACGCCCAGCCCAAGTATTGGGG - Intronic
1023218188 7:37887934-37887956 TAGGTCCTGCCCATGATTTGTGG + Intronic
1024435924 7:49354570-49354592 CAGGCTAAGCCCCAGTTTTGGGG - Intergenic
1027172856 7:75885176-75885198 GTGGCCCAGCCCAGGTTTTCTGG + Intronic
1031623717 7:123968051-123968073 TAGGCTAAGCCCCAATTTTGGGG - Intronic
1034898333 7:154891898-154891920 GAGCCGCAGCCCAAGTTTTCAGG - Intronic
1037108121 8:15135716-15135738 CAGGCCAAGCCCCAGTTCTGGGG - Intronic
1038460113 8:27709295-27709317 TGGGCCTTACCCAAGTTTTGGGG + Intergenic
1045652157 8:104351391-104351413 TAGGCTAAGCCCCAATTTTGGGG - Intronic
1047534123 8:125703813-125703835 TGGGCTAAGCCCCAGTTTTGGGG - Intergenic
1048964439 8:139605056-139605078 TAGGAGCTGCCCAAGTATTGGGG - Intronic
1049558121 8:143293770-143293792 GAGGCCCAGCCCTGGTCTTGTGG - Intronic
1049588125 8:143441228-143441250 TAGGCTCCGTCCAAGTCTTGGGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055287958 9:74750762-74750784 TAGTCCCACCCCAAGTTTCTAGG + Intronic
1059125116 9:111677039-111677061 TAAGCCCAGCCCAAGTCTGCAGG - Intergenic
1060967719 9:127721031-127721053 TGTGCCCAGCCCAGGTTGTGTGG - Intronic
1060991184 9:127850096-127850118 TAGTTCCAGCCCAGGCTTTGGGG - Intronic
1061374140 9:130214224-130214246 TCGGCCCAGCCCCAGGTCTGAGG - Intronic
1062309684 9:135929150-135929172 TGGGCCCACCCCCAGTTATGTGG + Intergenic
1062366685 9:136212997-136213019 TAGGACCAGCCCTAGTGTAGTGG - Intronic
1188606232 X:32033875-32033897 TAGGCCCTGCAAAAGTTATGGGG + Intronic
1195054587 X:101131300-101131322 CACACCCAGCCCAAGTTTTAGGG + Intronic
1199041781 X:143122819-143122841 TGGGCTGAGCCCAAATTTTGGGG + Intergenic
1200145520 X:153924446-153924468 GAGGGCCAGCCCTAGTTTAGGGG - Intronic