ID: 1066686958

View in Genome Browser
Species Human (GRCh38)
Location 10:37990750-37990772
Sequence CCTCTTCAGAAGACAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066686958_1066686967 20 Left 1066686958 10:37990750-37990772 CCCCACACTGTCTTCTGAAGAGG No data
Right 1066686967 10:37990793-37990815 GAGTGCCATCTTTCCCTACCTGG No data
1066686958_1066686965 -7 Left 1066686958 10:37990750-37990772 CCCCACACTGTCTTCTGAAGAGG No data
Right 1066686965 10:37990766-37990788 GAAGAGGGCTCTCTGGGCCATGG No data
1066686958_1066686968 21 Left 1066686958 10:37990750-37990772 CCCCACACTGTCTTCTGAAGAGG No data
Right 1066686968 10:37990794-37990816 AGTGCCATCTTTCCCTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066686958 Original CRISPR CCTCTTCAGAAGACAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr