ID: 1066688451

View in Genome Browser
Species Human (GRCh38)
Location 10:38003234-38003256
Sequence CGCAACCGACTCGGGAGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066688451_1066688456 -7 Left 1066688451 10:38003234-38003256 CCGCAACTCCCGAGTCGGTTGCG No data
Right 1066688456 10:38003250-38003272 GGTTGCGTTTGCACTGTCAGGGG No data
1066688451_1066688457 -3 Left 1066688451 10:38003234-38003256 CCGCAACTCCCGAGTCGGTTGCG No data
Right 1066688457 10:38003254-38003276 GCGTTTGCACTGTCAGGGGAAGG No data
1066688451_1066688455 -8 Left 1066688451 10:38003234-38003256 CCGCAACTCCCGAGTCGGTTGCG No data
Right 1066688455 10:38003249-38003271 CGGTTGCGTTTGCACTGTCAGGG No data
1066688451_1066688454 -9 Left 1066688451 10:38003234-38003256 CCGCAACTCCCGAGTCGGTTGCG No data
Right 1066688454 10:38003248-38003270 TCGGTTGCGTTTGCACTGTCAGG No data
1066688451_1066688458 11 Left 1066688451 10:38003234-38003256 CCGCAACTCCCGAGTCGGTTGCG No data
Right 1066688458 10:38003268-38003290 AGGGGAAGGCTCCAATAAACAGG No data
1066688451_1066688460 30 Left 1066688451 10:38003234-38003256 CCGCAACTCCCGAGTCGGTTGCG No data
Right 1066688460 10:38003287-38003309 CAGGAGAGCCATTCTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066688451 Original CRISPR CGCAACCGACTCGGGAGTTG CGG (reversed) Intergenic
No off target data available for this crispr