ID: 1066689288

View in Genome Browser
Species Human (GRCh38)
Location 10:38010780-38010802
Sequence TGGGGTAAGCCCCAGTGGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066689284_1066689288 -10 Left 1066689284 10:38010767-38010789 CCCGACGAGGGAGTGGGGTAAGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1066689288 10:38010780-38010802 TGGGGTAAGCCCCAGTGGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066689288 Original CRISPR TGGGGTAAGCCCCAGTGGGT TGG Exonic
900151557 1:1181183-1181205 GGGTGTCAGGCCCAGTGGGTTGG - Intronic
901664656 1:10819497-10819519 TGGTAGAAGCCCCATTGGGTGGG + Intergenic
903378127 1:22879225-22879247 AGTGGTCAGCCCCTGTGGGTTGG + Intronic
905873462 1:41417903-41417925 TGAGGGAGGCCACAGTGGGTAGG + Intergenic
906672309 1:47665308-47665330 TGGGGTAAGCCTCACTGAGAAGG - Intergenic
908934252 1:69355732-69355754 TGGGGTAAGCCCCAATTTGGGGG - Intergenic
914407975 1:147395837-147395859 TGGGCTAAGCCCCAGTTGTGGGG - Intergenic
916755926 1:167770357-167770379 AGGGTTAAGGCCCAGTGGGAGGG - Intronic
918112793 1:181472198-181472220 AGTGGTTAGCACCAGTGGGTGGG + Intronic
918242525 1:182633498-182633520 CTGGGTAAGCCCCAGAGGTTAGG + Intergenic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
922933705 1:229408623-229408645 CTGGGTGAGCCTCAGTGGGTGGG - Intergenic
923202488 1:231725702-231725724 TGGGATAAGCCCCAGTTTGGGGG + Intronic
924775630 1:247113045-247113067 TGGGGGAAGCCCCGGGGGGAGGG - Intergenic
1063451508 10:6153416-6153438 TGGGGTAAGCCTGTGTGGCTTGG + Intronic
1063966791 10:11352293-11352315 TGGGTTAAGCCCCAGTTTGGGGG - Intergenic
1065976321 10:30845949-30845971 TAGGGAGAGCCACAGTGGGTAGG - Intronic
1066689288 10:38010780-38010802 TGGGGTAAGCCCCAGTGGGTTGG + Exonic
1067003399 10:42638455-42638477 TGAGGTAAGCCTCCGCGGGTTGG - Exonic
1067479353 10:46585089-46585111 TGGGGTGAGCCCAAATGGGGTGG - Intronic
1067615386 10:47756712-47756734 TGGGGTGAGCCCAAATGGGGTGG + Intergenic
1067788889 10:49272813-49272835 AAGGGCAGGCCCCAGTGGGTGGG + Intergenic
1070598824 10:77851576-77851598 TGAGGTCAGGCCCAGTGGCTGGG - Intronic
1071630788 10:87216663-87216685 TGGGGTGAGCCCAAATGGGGTGG + Intergenic
1073839238 10:107479592-107479614 AGGGGAAAGCCACATTGGGTTGG - Intergenic
1075092694 10:119452476-119452498 AGGGGTCGGCCCCAGTGGCTTGG - Intronic
1075257822 10:120939413-120939435 TGGGGCAAGCCAGAGTGGGCTGG - Intergenic
1078317978 11:10307661-10307683 TAGGGGGAGCCCTAGTGGGTTGG + Intergenic
1080695596 11:34600672-34600694 TGGGGTAAGGCCAAGAGGTTTGG - Intergenic
1083674097 11:64316013-64316035 TGGGGTCAGCCCCAAGGGCTGGG + Exonic
1084033585 11:66494864-66494886 TGGGAGATGCCCCAATGGGTAGG - Intronic
1084460452 11:69294036-69294058 TGGGGCTAGCCCAGGTGGGTGGG - Intergenic
1084514308 11:69627868-69627890 TGTGGTAGGCCCCCGGGGGTGGG + Intergenic
1085763786 11:79264580-79264602 TGGGGAAAACATCAGTGGGTTGG + Intronic
1088795231 11:113261804-113261826 TGGGGTGAGACTCACTGGGTAGG + Intronic
1090420692 11:126573072-126573094 TGGGCTAAGGTCCAGTGGGCTGG + Intronic
1091119776 11:133047231-133047253 TAGGGGAAACCCCAGAGGGTTGG + Intronic
1091393661 12:140847-140869 TGGGGTAAGACCCAGGAGGCAGG + Intronic
1091998881 12:5017224-5017246 TGGAGTAAGACCCAGAGTGTGGG + Intergenic
1097234659 12:57530953-57530975 TGGGGTGAGCCCAAGCAGGTAGG + Intronic
1103781618 12:123402562-123402584 TGGGGTGAGCCACACTGGTTTGG + Intronic
1105344329 13:19559944-19559966 TGGGGTCAGCCCCAAGGGCTGGG - Intergenic
1105535705 13:21261630-21261652 TGGGGTCAGCCCCAAGGGCTGGG + Intergenic
1107014009 13:35694775-35694797 TGGGGAAACCCCCAGAGGCTGGG + Intergenic
1107883707 13:44856119-44856141 TAGGGTAATGCCAAGTGGGTTGG - Intergenic
1111008131 13:82276349-82276371 TGGAGAAAGGCCCACTGGGTGGG + Intergenic
1119520338 14:75280035-75280057 TGGAGTAAGCCCCAGCGGAGGGG - Exonic
1123626202 15:22228394-22228416 TGGGGTAAGCCCCACTTTGAAGG + Intergenic
1125416192 15:39455569-39455591 TGGGGAAAGCCCCACTGAGTGGG + Intergenic
1127307602 15:57723398-57723420 TGGGGGAATGGCCAGTGGGTGGG - Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1129937329 15:79461679-79461701 TTGGGTAAGAGCCAATGGGTTGG + Intronic
1132864281 16:2085907-2085929 TGGGGTAGGCCCCTGGGGGCAGG + Intronic
1134021307 16:10923346-10923368 AGGGGAGAGCCGCAGTGGGTTGG + Intronic
1134401423 16:13913783-13913805 TGGGATAAGCCCCAGTTGTGGGG - Intergenic
1134539563 16:15054100-15054122 AGGGGAAGGGCCCAGTGGGTGGG - Intronic
1135095323 16:19559928-19559950 TGGGGGAAGCCGAGGTGGGTGGG - Intronic
1136687126 16:32002198-32002220 TGGGGTGAGCCCCAGTCCTTGGG + Intergenic
1136787739 16:32945749-32945771 TGGGGTGAGCCCCAGTCCTTGGG + Intergenic
1136882042 16:33908040-33908062 TGGGGTGAGCCCCAGTCCTTGGG - Intergenic
1138271093 16:55696368-55696390 GGGGGTCAGGCCCAGTGGGATGG - Intronic
1142304571 16:89278292-89278314 TGGGAAAGACCCCAGTGGGTAGG + Intronic
1203089967 16_KI270728v1_random:1207406-1207428 TGGGGTGAGCCCCAGTCCTTGGG + Intergenic
1144063344 17:11602620-11602642 TGGGGAGAGCCACAGTGAGTTGG - Intronic
1145017675 17:19409841-19409863 TGGGACAAGCCCCTGTGTGTTGG - Intergenic
1145777806 17:27541415-27541437 TGGGGTACAGCCCAGAGGGTAGG + Intronic
1146088001 17:29848096-29848118 TGGGCTAAGCCCCAGTTTGGGGG + Intronic
1147148094 17:38497867-38497889 TGGGGTGAGCCCCAGTCCTTGGG + Intronic
1147420390 17:40319532-40319554 TGGGGTAAGCAGCAGGGGGTGGG - Intronic
1148050503 17:44767812-44767834 TGGGGAAAGCCCCAGCTGATGGG - Intronic
1148117162 17:45182931-45182953 TGGAGTAAACCCCAGTGCGGAGG - Intergenic
1149431050 17:56595899-56595921 TGGGGTCAGCTCCAGGGGGCCGG - Intergenic
1149684608 17:58528142-58528164 TGGGGTAGTCCCCACTGGCTTGG - Intronic
1151977862 17:77492550-77492572 TGTGGCAAACACCAGTGGGTGGG + Intronic
1156312761 18:35940055-35940077 GGGAGGAAGCCCCAATGGGTTGG - Intergenic
1156457357 18:37302275-37302297 TTGGCTAAGCCCCAGTGTGTGGG + Intronic
1157413510 18:47483368-47483390 CGGGGAAAGCCACGGTGGGTGGG - Intergenic
1160426009 18:78779818-78779840 TGGGGTCTGCCGCAGGGGGTGGG - Intergenic
1162094338 19:8301855-8301877 AGGAGGAAGCCACAGTGGGTGGG + Intronic
1162636953 19:11976350-11976372 GGGGTAAAGCCACAGTGGGTTGG - Intronic
1163529994 19:17843344-17843366 TGGGGTTTGACCCAGGGGGTTGG - Intronic
1164779867 19:30883659-30883681 TGGGCTAAGCTCCAGTGTGGAGG + Intergenic
1167292121 19:48630144-48630166 TGGGGTAGGCCTCAGTGAGTCGG + Exonic
1167297818 19:48662104-48662126 TGGGGTCAGTCACAGTGGGCAGG + Intronic
925937404 2:8778157-8778179 TGGAGAAACCCCCAGTGGCTGGG + Intronic
927485838 2:23487909-23487931 TGGGAGAAGCCACAGTGGCTCGG + Intronic
928215381 2:29356964-29356986 TGGCTGAAGCCCCAGAGGGTGGG - Intronic
928870119 2:35965957-35965979 TGGTGTAAGCCCCAGTATGAGGG - Intergenic
930261600 2:49153401-49153423 TGGAGTCAGTCACAGTGGGTTGG + Intronic
930740061 2:54823258-54823280 TAGGCTGAGCCTCAGTGGGTGGG + Intronic
931610171 2:64090488-64090510 TAGGGAAAGCCCCACTGGGAAGG - Intergenic
937042245 2:118831816-118831838 TGGGGTGGGCCCCCGTGGGATGG - Intergenic
945369538 2:208999850-208999872 TGGGCTAAGCCCCAGTTTGGGGG + Intergenic
946155796 2:217805983-217806005 TGGGGTAATGCCCAGGTGGTGGG + Intronic
946168798 2:217881378-217881400 TGGGGTCAGACCCTGGGGGTGGG + Intronic
948250249 2:236522100-236522122 TGGGGTAAGCTGCACTTGGTGGG + Intergenic
1168949144 20:1784650-1784672 AGGGCTAAGCTGCAGTGGGTGGG + Intergenic
1171456361 20:25274949-25274971 TGGGGGAAGCCCCGCTGGGCAGG + Intronic
1173858987 20:46269805-46269827 TGGGGAAATCCGCAGGGGGTAGG - Intronic
1175578196 20:60078530-60078552 TGGTGTAGGCCCCAGTGGCAGGG + Intergenic
1176417331 21:6484290-6484312 TGTGGTGAGACACAGTGGGTGGG - Intergenic
1178395933 21:32243643-32243665 TTGGGTAAACCCCTGTGAGTAGG - Intergenic
1179692827 21:43092623-43092645 TGTGGTGAGACACAGTGGGTGGG - Intergenic
1181581610 22:23831887-23831909 ATGGGTCAGCCCCAGAGGGTGGG + Intronic
1182359043 22:29735924-29735946 TGGAGTGAGCACCAATGGGTGGG - Intronic
949352082 3:3133851-3133873 TGGGGTAAGGGGCAGTGAGTGGG - Intronic
951296130 3:20937067-20937089 TGGGCTAAGCCCCAGTTTGGGGG - Intergenic
953845369 3:46422367-46422389 TGGGGGAGCCCCCTGTGGGTGGG + Intergenic
954049556 3:47962323-47962345 TGGGTTAAGCCCCAGTCTGGGGG + Intronic
954150417 3:48654529-48654551 GGGGGTAGGACCCAGAGGGTAGG + Intronic
954455833 3:50599398-50599420 AGGGCTAGGACCCAGTGGGTGGG - Intergenic
954691347 3:52397219-52397241 AGAGGCAAGCCCCAGTGGGCAGG - Intronic
957020220 3:75118321-75118343 TTCCGTGAGCCCCAGTGGGTAGG + Intergenic
961040151 3:123672486-123672508 TGGGGTGGGCACCAGTGGGGTGG + Intronic
963017446 3:140839556-140839578 TGGGGTAGGGCACAGTGGGGAGG - Intergenic
963477784 3:145829116-145829138 TGGGGAAAGGCCCTTTGGGTGGG - Intergenic
964754018 3:160078375-160078397 GTGGGTAAGGCCTAGTGGGTCGG - Intergenic
966225038 3:177589144-177589166 TGAGATAAGACCCAGTGAGTGGG + Intergenic
967763107 3:193247253-193247275 TGGTGTAAGCACCTGTGGGGTGG - Intronic
968620999 4:1603470-1603492 GGCTGGAAGCCCCAGTGGGTAGG + Intergenic
968746118 4:2361529-2361551 TGGGGCCTGCCCCAGTGGGTGGG - Intronic
970360231 4:15301972-15301994 TGCGATAAGCCCCTGTGGTTTGG - Intergenic
974836392 4:67256438-67256460 TGGGATAAGCCCCAGTTGTGGGG - Intergenic
981853271 4:149256902-149256924 TGGGGTAAGCCCATGTGGGAAGG + Intergenic
984319155 4:178169392-178169414 TGGGGTGAGTGCCTGTGGGTAGG + Intergenic
986165161 5:5266667-5266689 TGGGGATGGCCCCAGTGGGAAGG + Intronic
986701161 5:10409988-10410010 TGGGGAAAGCCTCACTGAGTTGG + Intronic
986741948 5:10712374-10712396 TGGGGGAAGCTCCTGTGGGCTGG + Intronic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
989164968 5:38424896-38424918 TGGGGTCAGCGCCACTGTGTTGG + Intronic
1000351781 5:160358080-160358102 TGGGGCAGGCCCCAGTGCCTGGG + Intronic
1001453701 5:171845274-171845296 TGGGGTAGGGCCTAGTGGGGAGG + Intergenic
1002559113 5:180069432-180069454 TGGAGCAAGCCCCTGTGGGACGG + Intronic
1010723883 6:79312051-79312073 TGGGGGGACCCCCTGTGGGTGGG + Intergenic
1013313910 6:108923370-108923392 TGGGGGAGGGCCCAGTGGGTGGG + Intronic
1013437340 6:110124020-110124042 TGGTGTAAGCCCTTGTGGGGTGG - Intronic
1015098588 6:129447595-129447617 TGGGATAAGCCTCACTGGTTAGG + Intronic
1017152152 6:151290446-151290468 TGGGGTAACACCCAGTGGCATGG - Intronic
1017901743 6:158723986-158724008 TGGGGTAAGCCTGAGAGGGAAGG - Intronic
1018928331 6:168222533-168222555 TGGGGTAAGCCCCAGCCTGAGGG - Intergenic
1019564236 7:1671632-1671654 TGGGGGAAACCCCATTGGGTTGG + Intergenic
1021121438 7:16800316-16800338 TGGGGTAGGCCACTGTGGGCAGG + Intronic
1026222969 7:68416195-68416217 TGGGCTAAGCCCCAGTTTGGGGG + Intergenic
1026623835 7:71975037-71975059 TGGTGAAAGCCCCAGCTGGTTGG - Intronic
1027599086 7:80215941-80215963 TGGGGTGAGCGCCAGTGTGGAGG + Intronic
1029497099 7:100901737-100901759 TGCGCCCAGCCCCAGTGGGTAGG + Intergenic
1031847548 7:126824569-126824591 TGGGCTTAGCCACAGTTGGTAGG - Intronic
1037058484 8:14476264-14476286 TGGGGCAGGTCCCAGTGAGTTGG - Intronic
1037915307 8:22769313-22769335 TGAGATAAGCCCCAGAGGGCTGG - Intronic
1038695885 8:29805904-29805926 AGGGGTAAGCCCGAGTGAATGGG + Intergenic
1039441982 8:37601480-37601502 TGGGGTTAGCACCCGGGGGTGGG + Intergenic
1043516679 8:81001221-81001243 TGGGCTAAGCCCCAGGAGGGAGG + Intronic
1044542291 8:93421264-93421286 TGGGTACAGCCTCAGTGGGTGGG - Intergenic
1044840031 8:96329517-96329539 TGGGGGCAGGCCCAGTGAGTGGG + Intronic
1044962807 8:97547375-97547397 TGGGCTAAGCCCCAGTGTTAGGG + Intergenic
1049799876 8:144512814-144512836 TGGGGTAAGCCACAGGGGTGTGG - Intronic
1054921054 9:70542486-70542508 TGAGAGAAGGCCCAGTGGGTGGG + Intronic
1057225426 9:93290530-93290552 TGGATAAAGCCCCAGTTGGTGGG + Intronic
1057380078 9:94559578-94559600 TGGGGACAGCCACAGTGGCTGGG + Intronic
1061886890 9:133595679-133595701 TGGGGGAAGCCACTGTGGGAAGG - Intergenic
1187014008 X:15308204-15308226 GGGTGTAAGCCCCAGTGTGAAGG - Intronic
1188340012 X:28987908-28987930 TTGAGCAAGCCACAGTGGGTTGG + Intronic
1190730347 X:53221750-53221772 GGGAGGAAGCCCCAGGGGGTGGG + Intronic
1193625881 X:83819544-83819566 TGGGTTAAGACCCACTGGCTTGG - Intergenic
1195416327 X:104623613-104623635 TGGGGTAGGCCTCAATGGCTGGG - Intronic