ID: 1066692371

View in Genome Browser
Species Human (GRCh38)
Location 10:38043006-38043028
Sequence GTTCAAATCCACAATTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066692371 Original CRISPR GTTCAAATCCACAATTATTG TGG (reversed) Intronic
901155211 1:7132092-7132114 GTTCATTTTCACAATTATTTTGG + Intronic
903255474 1:22095652-22095674 GTTCAAATGCAACATTATTCTGG - Intergenic
909999217 1:82321985-82322007 GGACAAATCCAGATTTATTGAGG + Intergenic
910443632 1:87278621-87278643 GTTGAAATCCACAATTTTACTGG + Intergenic
911220475 1:95240401-95240423 TTTCATGTCCAGAATTATTGTGG - Intronic
912260780 1:108109996-108110018 GATCAAATCCAGCATTATGGAGG - Intergenic
913456109 1:119032652-119032674 GTCTGAATCCCCAATTATTGAGG - Exonic
914447860 1:147765326-147765348 GTTCAAATAAACAATTAATGGGG + Intronic
918103527 1:181397261-181397283 GTTCCCATCCACCATTATTGTGG - Intergenic
918359518 1:183741529-183741551 GTTTAGAAACACAATTATTGTGG + Intronic
918934350 1:190901014-190901036 GTTCAAATTCACATTTCTTTTGG - Intergenic
919138823 1:193544513-193544535 TTCCAAATCCACAGTTATTTAGG + Intergenic
923799917 1:237198746-237198768 TTTGAAATCCACAATTTTTAGGG + Intronic
1063069569 10:2647796-2647818 GTTCAAATCCCTAATTAATAAGG - Intergenic
1064376068 10:14797265-14797287 ACTCAAATTCACAATTTTTGTGG + Intergenic
1064477703 10:15708533-15708555 GTTCAAATATACAGTTATTGGGG - Intronic
1065365568 10:24933494-24933516 GTTCAAATCATCATTTATTAGGG + Intronic
1066493541 10:35918426-35918448 GGTCAACTCTAAAATTATTGAGG - Intergenic
1066692371 10:38043006-38043028 GTTCAAATCCACAATTATTGTGG - Intronic
1067000347 10:42605638-42605660 GATCAAATCCACAATTATTGTGG + Intronic
1068738015 10:60436864-60436886 ATTTTAATCCACAAATATTGTGG + Intronic
1069156743 10:65038884-65038906 GTCCACATACACAATTAATGAGG - Intergenic
1069484703 10:68814240-68814262 CTTCAAACCAAAAATTATTGAGG + Intergenic
1071350692 10:84740453-84740475 TTTAAAATCCACAATTTTAGTGG - Intergenic
1072985119 10:100132759-100132781 GTTCACATTCACAGATATTGGGG - Intergenic
1073897013 10:108173482-108173504 GTTCAAACCCACAATGTTTAAGG - Intergenic
1075283226 10:121159374-121159396 GTTCAAAGCTAAAATTATTTTGG + Intergenic
1075977083 10:126705385-126705407 GTTCACATCCAAAATCTTTGGGG - Intergenic
1076213129 10:128667912-128667934 GGACAAAGCCACAATTATGGTGG + Intergenic
1077752278 11:4986283-4986305 TTAAAAATACACAATTATTGAGG - Intronic
1081409231 11:42736646-42736668 AGTCAAATCCATAATTATAGTGG + Intergenic
1081435013 11:43017866-43017888 GTTCAAATACCAAATTATTGAGG - Intergenic
1082942815 11:58726270-58726292 GTTCAAGACCCCAATTATTTGGG + Intronic
1086900337 11:92360391-92360413 GATCAAATCCACTATAGTTGGGG - Intronic
1087212359 11:95457115-95457137 TTTTAAATACAGAATTATTGTGG + Intergenic
1088017295 11:105076566-105076588 CTTCTAATCCACAAATATTTTGG - Intronic
1088171530 11:107003274-107003296 TTTCAAATCCAGTATGATTGAGG - Intronic
1089419860 11:118323455-118323477 GTTCATGTCAACATTTATTGAGG - Intergenic
1093007426 12:14065290-14065312 GTTAAAATGCAGAATCATTGGGG - Intergenic
1095230447 12:39732989-39733011 CTTCAAGTCCACAATTTTGGGGG + Intronic
1095324848 12:40877052-40877074 GTTCATACTCACAATTATTTTGG - Intronic
1095801882 12:46277623-46277645 GTTCACATTCATAATTATTAAGG - Intergenic
1097547884 12:61027308-61027330 GTTTTAATCCACAATATTTGTGG + Intergenic
1099788031 12:87292445-87292467 GTTCTTATCCAGAATGATTGGGG - Intergenic
1100293678 12:93240266-93240288 GTTCAAATCCACTAAGTTTGGGG + Intergenic
1104561557 12:129850049-129850071 TTTCAAATCCACAAATATATGGG - Intronic
1107152369 13:37126947-37126969 ATACAAATACACATTTATTGAGG - Intergenic
1109743610 13:66589461-66589483 GTAAATATACACAATTATTGTGG + Intronic
1111166631 13:84465832-84465854 ATTCATATTCACAATTGTTGGGG - Intergenic
1114407367 14:22469223-22469245 ATTCAAATCCAGATTTATTCTGG - Intergenic
1115261908 14:31463018-31463040 GTTGAAATCCACAATTTCTTGGG - Intergenic
1115476327 14:33816937-33816959 GTTCAAATCTACAATCATGTTGG + Intergenic
1115492124 14:33967716-33967738 ATTCAAATCCACAATGATTTGGG - Intronic
1115651666 14:35406336-35406358 ATGCAAATCTACAATGATTGAGG + Intergenic
1115787181 14:36838939-36838961 GTTCAACACCCCAATTAATGTGG + Intronic
1117330014 14:54703093-54703115 GTTTTAATCCCCAATTGTTGGGG + Intronic
1118138889 14:63057715-63057737 GTTCAAATCCATGATGATTAAGG - Intronic
1118499069 14:66340243-66340265 GTTCAAATTCACAATTACAAAGG + Intergenic
1120476330 14:84992769-84992791 AGTCAAATCCACAATCACTGTGG - Intergenic
1122992629 14:105244680-105244702 CTTCAAAACCACAATAATAGGGG + Intronic
1122992630 14:105244688-105244710 GTTAAAATCCCCTATTATTGTGG - Intronic
1125038626 15:35156995-35157017 TTACAAATCCAAAATTATAGTGG - Intergenic
1126203177 15:46012665-46012687 GTTCAAGTCCCCCACTATTGTGG + Intergenic
1127600652 15:60533336-60533358 GTCCAAAGTCACCATTATTGGGG - Intronic
1131137320 15:89947714-89947736 ATTCAAATCCTCATTTATTTTGG - Intergenic
1133341085 16:5036595-5036617 GTTCAAATGCAGAATTTCTGTGG - Intronic
1135886559 16:26314973-26314995 GTTAATATCCAGAATTATAGGGG + Intergenic
1139752257 16:69116199-69116221 CTTCAAAGCCACATTTTTTGAGG + Exonic
1140650116 16:77079062-77079084 CTTCAAATCCACATGGATTGAGG - Intergenic
1140690162 16:77475124-77475146 GGACAAATCAAAAATTATTGTGG + Intergenic
1144070443 17:11666727-11666749 GGTCAAACCCACAATAAATGAGG + Intronic
1144697514 17:17315111-17315133 TTTTAAATCAACAATTACTGTGG - Intronic
1146967319 17:37043512-37043534 GTTCACAGACACACTTATTGGGG + Intronic
1148036267 17:44663166-44663188 GTTCAATTCCACAAATAATAAGG + Intronic
1153367558 18:4274721-4274743 TTTCAAATACTCAATTGTTGTGG - Intronic
1155524905 18:26706192-26706214 GTTCCAACCAACATTTATTGAGG + Intergenic
1156775189 18:40779029-40779051 TTTCAAAGCCTCAATTATTCAGG - Intergenic
1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG + Intergenic
1159235603 18:65669037-65669059 GTACAAAGCCACAATTATGCAGG - Intergenic
1159241486 18:65749341-65749363 GTTAAAATGCTCAATTATTCTGG - Intergenic
1163425948 19:17241100-17241122 GTTGAAATACACAAATATGGAGG + Intronic
1164235663 19:23331095-23331117 GTGCAAATACACAAATATTTAGG - Intronic
1164905454 19:31963987-31964009 GTTCAACTCCAGGGTTATTGTGG - Intergenic
1166800407 19:45453351-45453373 GTTCAAATCCATAGTTTTTAGGG - Intronic
1167731412 19:51259434-51259456 TTTCAAATTAACAATTAGTGTGG - Intronic
1167734523 19:51284345-51284367 AAACAAATCCACAATCATTGTGG - Intergenic
925579070 2:5391700-5391722 CTTCAACTCCACAGTTACTGTGG + Intergenic
925609027 2:5688469-5688491 GTTAAAACCCACTATTAATGAGG - Intergenic
929343461 2:40851420-40851442 GTGCACATCCACACTGATTGTGG + Intergenic
931196765 2:60059152-60059174 CTATAAATCCACAATCATTGAGG + Intergenic
933289381 2:80420849-80420871 GTTCAAAGCTTCCATTATTGTGG - Intronic
933845095 2:86319393-86319415 GATCACATTCACAGTTATTGGGG - Intronic
934980774 2:98837921-98837943 GTTTAAGTCCACAATAACTGTGG - Intronic
935445538 2:103152545-103152567 GTCTACATCCAGAATTATTGAGG + Intergenic
935598445 2:104897918-104897940 GTTCAAAACCACAACTCATGTGG + Intergenic
940086888 2:149870011-149870033 GTTCTATTCCATCATTATTGAGG - Intergenic
940667370 2:156625353-156625375 GTACAAATAAACAATTAGTGTGG + Intergenic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
940930007 2:159416898-159416920 GTTCTCACCCACAATTATTTTGG - Intronic
941975667 2:171402278-171402300 ATTCATATCCAGAATTATTTAGG - Intronic
945766013 2:213978600-213978622 GTTCAAAACCACAAAATTTGGGG - Intronic
947157973 2:227182731-227182753 CTTAACACCCACAATTATTGGGG + Intronic
948239103 2:236414047-236414069 TTTTAAATCCAGAATTGTTGTGG - Intronic
1168765048 20:376368-376390 GTTCAAAACCACATCTATTTTGG - Intronic
1179768684 21:43596154-43596176 CTTAAAATCTACCATTATTGTGG - Intronic
1183651243 22:39154813-39154835 AGACAAATCCACAATTATAGTGG + Intergenic
949230668 3:1746149-1746171 GGTCACATCCACAAATACTGTGG + Intergenic
949245391 3:1920975-1920997 CTTCAAATTCACATTTATTTAGG + Intergenic
952017907 3:28980979-28981001 TTTTAAATCCTCATTTATTGGGG + Intergenic
952280809 3:31921443-31921465 GCTCAAACCCACAATGATGGGGG + Intronic
955896906 3:63710082-63710104 TTTCAAATCCCCAAACATTGAGG + Intergenic
957138713 3:76324705-76324727 ATTTAATTCCAGAATTATTGAGG - Intronic
960971023 3:123140293-123140315 ATTCAAATCCAAACTTATTATGG - Intronic
962612302 3:137089031-137089053 AGACAAATCCACAATTATAGTGG - Intergenic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
972926360 4:44013965-44013987 GTTCAAAGCCACAATATTTCTGG + Intergenic
973758343 4:54096196-54096218 GTTCTTTTCCACTATTATTGAGG + Intronic
974059916 4:57022910-57022932 GATGAAATCCACAATTTCTGTGG + Intronic
976244618 4:82994812-82994834 GTTAAAATCCCCAAATATGGTGG + Intronic
976892302 4:90064710-90064732 GTTCATATCATCAATTACTGAGG + Intergenic
981030420 4:140119778-140119800 CTTCAAATGCATAAATATTGTGG - Intronic
981267922 4:142808894-142808916 TAACAAATCCACAATTATTTAGG - Intronic
983453551 4:167935042-167935064 TTTCATATCCACAAATAATGTGG - Intergenic
986568591 5:9141565-9141587 TTTCAAAAACACACTTATTGAGG + Intronic
989222495 5:38984596-38984618 CTTTAAATCAACAAGTATTGTGG + Intronic
993769734 5:91911322-91911344 GTTCAATGTCACAGTTATTGAGG + Intergenic
993889694 5:93458406-93458428 GTACAAATGCACAATTAGTAGGG + Intergenic
998902293 5:146869083-146869105 ATTCAAATCCACAATGGTTTTGG + Intronic
1000184821 5:158848870-158848892 GTTCAAGTCCACAGTAACTGAGG + Intronic
1001900713 5:175426432-175426454 GTTCATTTCCAAAATTATTTTGG - Intergenic
1001926033 5:175637837-175637859 GGTCACATTCACAAGTATTGGGG - Intergenic
1003409517 6:5850577-5850599 CTTCCAACCCACAATGATTGAGG - Intergenic
1004628799 6:17401692-17401714 ATGCAGATCCACAATTATTTAGG + Intronic
1008015184 6:46510739-46510761 TATCAATTCCACAAATATTGAGG + Intergenic
1008778625 6:55072981-55073003 GTTCATCTCCACATTTATTAGGG - Intergenic
1008913238 6:56759088-56759110 ATTTAAAGCCACTATTATTGTGG + Intronic
1008974820 6:57412579-57412601 GTTCAACTCTTCAATTATTCAGG + Intronic
1009163706 6:60314085-60314107 GTTCAACTCTTCAATTATTCAGG + Intergenic
1010714320 6:79210565-79210587 GTTCATCTCAACACTTATTGAGG - Intronic
1011423458 6:87200310-87200332 GTTCAAAGCCAGAAATACTGTGG + Intronic
1011436988 6:87348798-87348820 CTTCAAATACACAGATATTGGGG + Exonic
1014966868 6:127764943-127764965 TTTCAAATTCACAGTTAATGAGG - Intronic
1015065076 6:129014760-129014782 GTTCAAATATCTAATTATTGGGG - Intronic
1016159754 6:140864083-140864105 CTTCAAATTCACCAATATTGTGG - Intergenic
1017583303 6:155891277-155891299 CTTCCAATCCATAAATATTGGGG - Intergenic
1018368056 6:163141856-163141878 GATCAAATAAAAAATTATTGAGG + Intronic
1018557870 6:165067365-165067387 GTTGAAATCTACTATTATTGTGG - Intergenic
1020159409 7:5757208-5757230 GGACAAATCCACCATTATAGTGG - Intronic
1021593155 7:22286680-22286702 TTTCAAAGCCACAATTCTTAAGG - Intronic
1023114195 7:36844934-36844956 TTTTAAATCCACATTTATTTTGG + Intergenic
1027885268 7:83896298-83896320 ATTCAAATGCAAAATTAGTGGGG + Intergenic
1028020992 7:85771969-85771991 TTTCATAGCTACAATTATTGTGG + Intergenic
1029219838 7:98979526-98979548 GGTCAAATCCACACATATGGAGG + Intronic
1030707343 7:112707635-112707657 GTTCATGTTCACAATTATTGTGG + Intergenic
1031610554 7:123821391-123821413 GCTCAAAATCATAATTATTGGGG - Intergenic
1032972440 7:137181131-137181153 GTTAAAAGCAAAAATTATTGTGG + Intergenic
1033958590 7:146883412-146883434 GTTCAAATTTGCAGTTATTGAGG + Intronic
1034044464 7:147913186-147913208 GTTTAAATCCAGATTTATTGGGG + Intronic
1041144886 8:54864063-54864085 GTTCAAATCTAAAATAAATGGGG + Intergenic
1041385986 8:57303338-57303360 GGTTAAATCCACAATTTATGGGG + Intergenic
1041940021 8:63376706-63376728 GTTCAAATGTCAAATTATTGGGG - Intergenic
1044186338 8:89255891-89255913 GCTGAAGTCCCCAATTATTGAGG + Intergenic
1044850870 8:96426165-96426187 GTGCACTTCCACATTTATTGTGG - Intergenic
1045316191 8:101045775-101045797 TTTCAGATCCACAATTCTTGGGG + Intergenic
1055101949 9:72475153-72475175 GTTCAAATACATATTTATTGTGG - Intergenic
1056523392 9:87420693-87420715 GTTGTAATCCCCAGTTATTGAGG - Intergenic
1058551617 9:106121396-106121418 GTCCAAATCCTCCATAATTGAGG + Intergenic
1058784733 9:108375961-108375983 GTACAAATCGACAATTTTTCTGG + Intergenic
1059058524 9:111010488-111010510 GTTAAAATGTACAATCATTGAGG + Intronic
1185938674 X:4288534-4288556 GTTCACATTCACAGGTATTGTGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1195302091 X:103540210-103540232 GTTTAAAGCCACAAATTTTGTGG - Intergenic
1196199633 X:112870913-112870935 GATCAAATCCAGAATTATGAAGG - Intergenic
1199466976 X:148149112-148149134 GTGCAAAGCCACAATAATTAAGG + Intergenic