ID: 1066693661

View in Genome Browser
Species Human (GRCh38)
Location 10:38058792-38058814
Sequence CTGGTCCTGGCACTTTGTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066693661_1066693666 12 Complete closest: 659
total_pairs: 2
max_distance: 1000
Left 1066693661 10:38058792-38058814 CCAAAACAAAGTGCCAGGACCAG 0: 1
1: 0
2: 0
3: 24
4: 273
Right 1066693666 10:38058827-38058849 ATGTGTTTTTGAGATACTTAAGG 0: 1
1: 0
2: 3
3: 28
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066693661 Original CRISPR CTGGTCCTGGCACTTTGTTT TGG (reversed) Exonic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902099670 1:13975767-13975789 GTGGTCCTGGCACATTGATGGGG + Intergenic
904386410 1:30145369-30145391 CAGTTCGTGGCAGTTTGTTTGGG + Intergenic
904561217 1:31398509-31398531 CTGCTCCTGGCCCTTTTGTTTGG - Intergenic
908367290 1:63438768-63438790 CTGTTTCTGGTATTTTGTTTTGG - Intergenic
908599228 1:65720922-65720944 CTGGTTCTGCCACTTCATTTTGG - Intergenic
909689570 1:78391913-78391935 CTGGTCCTGGGCTTTTTTTTTGG + Intronic
910475099 1:87597799-87597821 ATGGTCCTGGCCCTTTCTATGGG - Intergenic
910929946 1:92433383-92433405 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
911001627 1:93171577-93171599 CTGGTCCTGGTCCTTTCTTTTGG - Intronic
911979882 1:104553867-104553889 CTGGTCATGGGATTTTTTTTTGG - Intergenic
912150833 1:106856733-106856755 CTGGTCCTGGGCGTTTTTTTTGG - Intergenic
914194703 1:145439830-145439852 CTAGACCTGGCGCTTTGTTCTGG + Intergenic
914475977 1:148022395-148022417 CTAGACCTGGCGCTTTGTTCTGG + Intergenic
917025458 1:170636929-170636951 CAGTTCCTGGTACTTTGTTATGG + Intergenic
917065754 1:171091478-171091500 CTGTTCCTGACACTGTCTTTAGG - Intronic
917128973 1:171720675-171720697 CTAGTCCTGGAATTTTCTTTGGG - Intronic
918973095 1:191445397-191445419 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
919271745 1:195357558-195357580 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
919332567 1:196190184-196190206 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
922951848 1:229564447-229564469 CAGTTCCTGGCACTTTGTTATGG + Intergenic
923179836 1:231505903-231505925 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
923320638 1:232829620-232829642 CTGTTCCTAGCACTGTGTTTAGG + Intergenic
924491005 1:244537600-244537622 TTGGGCCTGGTGCTTTGTTTTGG + Intronic
1064098826 10:12445412-12445434 TTGGTTCTGCCATTTTGTTTTGG + Intronic
1066144151 10:32539132-32539154 CTGGTCCTGGGCTTTTTTTTTGG + Intronic
1066611848 10:37257015-37257037 CTGGTCCTGGGCTTTTTTTTTGG + Intronic
1066693661 10:38058792-38058814 CTGGTCCTGGCACTTTGTTTTGG - Exonic
1068133672 10:52927630-52927652 CTGGTTCTGGGTCTTTGCTTTGG - Intergenic
1069154336 10:65007231-65007253 CTTGGCCTGACACTCTGTTTTGG + Intergenic
1069312336 10:67053820-67053842 GTGGTCCTCGGATTTTGTTTTGG - Intronic
1069355994 10:67585456-67585478 CTGGTCCTGGGCTTTTCTTTTGG + Intronic
1069360424 10:67635191-67635213 CTGGTCATGGGCCTTTTTTTTGG - Intronic
1069409760 10:68141078-68141100 CTGCGCCTGGCCCTTTTTTTGGG - Intronic
1069948328 10:72002370-72002392 CTGGGCCTGGCACCTTGGTAAGG - Intronic
1071794747 10:88991933-88991955 CTATGCCTGGCACTTTGTTGGGG - Intronic
1072037595 10:91577776-91577798 CTGGTTCTGTAACTGTGTTTGGG - Intergenic
1072213244 10:93266171-93266193 CTAGTCTTGGTACTTTGTTGCGG + Intergenic
1072865687 10:99058562-99058584 CTAGTCTTAGCACTTCGTTTAGG + Intronic
1073089562 10:100923182-100923204 CTGGTTTTGGCACTTTGTTATGG - Intronic
1074227357 10:111498254-111498276 CTGTTCCTGGCATTTTTCTTTGG + Intergenic
1074688487 10:115981255-115981277 GTGGTGCTGGCTGTTTGTTTAGG - Intergenic
1075880849 10:125849435-125849457 CTGGCCCTGGAAAGTTGTTTTGG + Intronic
1076174044 10:128351978-128352000 CTGGTCCTATTATTTTGTTTTGG + Intergenic
1077692032 11:4352077-4352099 CTGGTCCTGGATTTTTTTTTTGG + Intergenic
1079345727 11:19650491-19650513 CTGGTTGTGGTACTTTGTTATGG + Intronic
1081390007 11:42518154-42518176 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1081844077 11:46225910-46225932 CTGGACCTGACACTTTTTTTGGG - Intergenic
1083200442 11:61118199-61118221 CTGGCCCTGGCACTTCGAGTTGG - Exonic
1083722722 11:64611441-64611463 CTGGGCCTGGCACTTTGCTGGGG - Intronic
1083860371 11:65417183-65417205 CTGACCTTGGCACTTTGTTGTGG + Intergenic
1085946161 11:81276270-81276292 CTAGACCTTGCATTTTGTTTTGG - Intergenic
1086470482 11:87103993-87104015 CTGGTCTAGGCAATTTTTTTGGG - Intronic
1086608755 11:88728392-88728414 CTGGTCCTGGGCTTTTTTTTTGG - Intronic
1087161758 11:94955101-94955123 CTGTTAGTGGCACTTTGTATGGG + Intergenic
1088167260 11:106953643-106953665 CTGGTCCTTGCTTTTTTTTTTGG + Intronic
1089886987 11:121835795-121835817 CTGGTCCTGGGCTTTTCTTTGGG - Intergenic
1090655393 11:128839726-128839748 ATGGTCTTGGCACGTTTTTTGGG + Exonic
1091145350 11:133274599-133274621 CTGGTTGTGGTACTTTGTTATGG + Intronic
1091585419 12:1813346-1813368 CTAGTCCAGGCACTATATTTAGG + Intronic
1091700875 12:2660891-2660913 CTGTTCCTGGCATTTTTCTTTGG - Intronic
1094058365 12:26288300-26288322 CTGGCCTTGGCACTTGGTGTTGG - Intronic
1095582324 12:43814461-43814483 CTCGTCCTGGCCCTCTGTTCTGG + Intergenic
1095627428 12:44333264-44333286 CAGGGCCTGGCATATTGTTTGGG - Intronic
1097045131 12:56181955-56181977 CTGTTCCTGGCATTCTTTTTGGG + Intronic
1097176023 12:57143375-57143397 GGGGTTCTGGCACTTTGTTGGGG - Intronic
1097565038 12:61257520-61257542 CTGGTCCTGGACATCTGTTTTGG - Intergenic
1097884753 12:64717843-64717865 CTGGGCCTGGCACTATCCTTGGG + Intronic
1102340400 12:112116940-112116962 CAGGGCCTGGCACCTTGATTAGG + Intergenic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1106156167 13:27158704-27158726 CAGTTTCTGGCACTTTGTTATGG + Intronic
1108113809 13:47106132-47106154 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1108133179 13:47325811-47325833 TTGGTCTTGGCACTATGGTTGGG - Intergenic
1109470105 13:62792583-62792605 CAGTTCCTGGTACTTTGTTATGG + Intergenic
1109522218 13:63528653-63528675 CAGGTCCTGGGATTTTTTTTAGG + Intergenic
1110595330 13:77315160-77315182 CTGGTCCTGGAATTTTATTTTGG - Intronic
1111216573 13:85151016-85151038 CTGGTCCATGATCTTTGTTTTGG + Intergenic
1112362171 13:98728064-98728086 CTGGTCCAGGCAGTGTGCTTTGG + Intronic
1113140585 13:107144453-107144475 CTGTTTGTGGTACTTTGTTTTGG + Intergenic
1113431058 13:110250846-110250868 CTGGAGCTGACACTTGGTTTGGG - Intronic
1114488565 14:23080516-23080538 CTGTTCCTGGGATCTTGTTTTGG + Exonic
1114956014 14:27820252-27820274 CTGGTCTTGGGTCTTTTTTTTGG + Intergenic
1115184248 14:30666923-30666945 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1115511652 14:34143474-34143496 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1117614882 14:57524094-57524116 CTGGTCCTGGACTTTTTTTTGGG + Intergenic
1117655780 14:57954795-57954817 CTGGTCCTGGGCTTTTTTTTTGG - Intronic
1117876296 14:60253422-60253444 CTGATCCTGGCACGTTATTTAGG - Intronic
1118143324 14:63108974-63108996 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
1119882919 14:78115803-78115825 CTGCTCTTGGCACTATGTTAAGG - Intergenic
1123969762 15:25496219-25496241 CTGGGCCTGATGCTTTGTTTTGG - Intergenic
1123981050 15:25603579-25603601 CTGGTTCTGGGCCTTTCTTTAGG + Intergenic
1124083765 15:26526622-26526644 CTGGGCCTGGGACTTTTTGTGGG + Intergenic
1125534000 15:40432519-40432541 CTGGTCCTGGCTCTTGCTGTGGG + Intronic
1126044235 15:44623719-44623741 TTAGACCTGGCACTTTGATTAGG - Intronic
1129564914 15:76611446-76611468 CTGGTCCTGGGCTTTTTTTTGGG - Intronic
1130969672 15:88722029-88722051 GTGGTCCTGGCCCTCTGTTCTGG - Intergenic
1131264523 15:90907709-90907731 CTGGCCCTGGCAGTTTGTTAGGG - Intronic
1131628549 15:94150585-94150607 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1134862026 16:17568709-17568731 CTGGCCTGGGCACATTGTTTAGG + Intergenic
1137471382 16:48762233-48762255 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1139197563 16:64938557-64938579 CTGTTCCAGACATTTTGTTTAGG - Intergenic
1139695486 16:68671319-68671341 CAGTACCTGGCACTTTGTTATGG - Intronic
1141508762 16:84499017-84499039 CAGGTCTTGGCCCTTTGCTTTGG - Intronic
1141648690 16:85380841-85380863 CTGGTCTTTGCATTTTCTTTGGG + Intergenic
1145781677 17:27567823-27567845 CTGGTCCTGGCACCATTGTTTGG + Intronic
1146093299 17:29904020-29904042 CTGGTCCTGGGCTTTTTTTTTGG - Intronic
1146239066 17:31198381-31198403 CTGGTCCTAGCCTTTTCTTTGGG + Intronic
1147327259 17:39675409-39675431 TTGGTGCTGGCACTTTCTTCAGG + Intronic
1147525745 17:41220953-41220975 CTGGTCCTGGGCTTTTTTTTTGG - Intronic
1147859383 17:43508955-43508977 CTGGTCCAACCAATTTGTTTAGG + Intronic
1148615238 17:48996392-48996414 CGGGTCTCGGAACTTTGTTTGGG - Intergenic
1151014641 17:70540219-70540241 CTAGTCCTTGGACTTTATTTTGG - Intergenic
1151462985 17:74266237-74266259 CTGGTCCTGGTATTTTGCTCTGG - Intergenic
1151694056 17:75705132-75705154 CTGGGCCTGGCACTCTCTTAGGG - Intronic
1153916020 18:9745314-9745336 CTGGTCCTGAGCCTTTCTTTTGG - Intronic
1154229325 18:12540215-12540237 CTTTTCCTTCCACTTTGTTTTGG + Intronic
1155541707 18:26875166-26875188 CTGGTTCTAGCAATTTCTTTTGG - Intergenic
1155548646 18:26941105-26941127 CTGTTCATGGTACTTTGTTTTGG + Intronic
1156807816 18:41208188-41208210 CTGATCCGGGCACTGTGGTTAGG + Intergenic
1156822785 18:41392801-41392823 CAGGTCCAGGCACTTTGCTTTGG + Intergenic
1161578655 19:5068530-5068552 CGTGTCCTGGCACTTTCTCTTGG + Intronic
1165798509 19:38533084-38533106 CTGGGTCAGGCACCTTGTTTGGG - Intronic
1166616340 19:44251268-44251290 CTGGTCCTGGGCTTTTTTTTTGG - Intronic
925248672 2:2409923-2409945 CTTCTCCTGGCCCCTTGTTTTGG + Intergenic
925728783 2:6901441-6901463 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
926487296 2:13477770-13477792 CTGGACCTGTCACCTTGTATGGG - Intergenic
927670417 2:25064154-25064176 CTGGCCCTGGCTCTACGTTTCGG + Intronic
928246543 2:29633932-29633954 CTGGTCCTGGAGATTTCTTTTGG - Intronic
930764418 2:55070266-55070288 CTGTGCCTGGCCTTTTGTTTGGG - Intronic
932223945 2:70024400-70024422 CTGGGCCTGTCACTCTGGTTTGG + Intergenic
933606099 2:84385588-84385610 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
935125088 2:100215769-100215791 CATGTCTTGGCACCTTGTTTAGG + Intergenic
935476966 2:103534603-103534625 CTGGTCCTGGGCTTTTGTTATGG + Intergenic
935523620 2:104140270-104140292 CTGGTCCTGGCAATGTGTGGGGG - Intergenic
935903218 2:107814824-107814846 CGGTTTCTGGTACTTTGTTTTGG + Intergenic
937266162 2:120615820-120615842 CTGGGCCTGGAACTTGGTTTTGG - Intergenic
937699268 2:124845608-124845630 CTGGTCCTGGCCTTTTATTTTGG + Intronic
938610825 2:132945815-132945837 CTGGTCCTCTCACTAAGTTTGGG - Intronic
938964900 2:136379748-136379770 CTGCTCCAGGGACTGTGTTTTGG + Intergenic
939180704 2:138799447-138799469 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
941608790 2:167634720-167634742 CTGGACCTGGGATTTTTTTTTGG - Intergenic
941864680 2:170322391-170322413 CGGGTCCTGGCAGTTTGTAAGGG - Intronic
942725534 2:179002687-179002709 CTGCTCCTGGCATATTTTTTTGG - Intronic
943286846 2:186012295-186012317 CTGGTCCTGGGCTTTTGTTTTGG - Intergenic
947266449 2:228287544-228287566 CTGGTCCAGGTATTTTTTTTTGG + Intergenic
948150851 2:235743488-235743510 TTGGTCCTGGCACTCTCTGTGGG + Intronic
948385703 2:237579307-237579329 CGGCTCATGGGACTTTGTTTTGG - Intronic
948718693 2:239882647-239882669 CTGGTCCAGGCACTATGTGCTGG + Intergenic
949020323 2:241737450-241737472 CTGGGGCTGGCACTTCCTTTTGG + Intronic
1170388890 20:15850820-15850842 CTGTTGCTGTCACTTTGTTAGGG + Intronic
1171062227 20:21976840-21976862 CTGGTCCTGGACCTTTTTTTTGG + Intergenic
1171126490 20:22606419-22606441 CTGGTGCTGGCAATTGGCTTGGG + Intergenic
1171314059 20:24170875-24170897 CTGGTCCTGGTTATTTCTTTTGG + Intergenic
1172781648 20:37440036-37440058 CTGGTCCTGGCACCTTGACCAGG - Intergenic
1173070709 20:39762203-39762225 CTGGTTCTTCCACTTTATTTGGG - Intergenic
1174877319 20:54241531-54241553 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1175004334 20:55666278-55666300 CTCATGCTGGCACTGTGTTTGGG + Intergenic
1177099471 21:16882334-16882356 CTGGTCCTGGGATTTTTTTTTGG - Intergenic
1177239084 21:18432780-18432802 CAGCTTGTGGCACTTTGTTTAGG + Intronic
1177463571 21:21444455-21444477 CTGGTCCTGGGCTTTTTTTTTGG + Intronic
1177642549 21:23862174-23862196 CTGGACATGGCAGTTTGTTCTGG - Intergenic
1178308640 21:31511196-31511218 CTGTTGGTGGCACTTTGTTAGGG + Intronic
1178812366 21:35895838-35895860 CTGGTTTTGGTATTTTGTTTAGG + Intronic
1180016924 21:45093210-45093232 CTGATCCAGGCACTTTGCTGGGG + Intronic
1180175660 21:46085957-46085979 CTGGGCCTGTCATTTTATTTGGG - Intergenic
1184207898 22:43016666-43016688 TTTGTCCTGGCACTGTGTGTTGG - Intergenic
1184682802 22:46080983-46081005 CTGGTTGTGGCAGTTTGTGTGGG + Intronic
1185224124 22:49643459-49643481 CTGGGCCTGGCTCTTGGCTTCGG - Intronic
950947672 3:16966638-16966660 CTGGTCCTGGACTTTTTTTTTGG + Intronic
951005922 3:17615507-17615529 CTGGTCCTGGACTTTTTTTTTGG + Intronic
952215943 3:31278384-31278406 CTGGTCCTTGGACTTTCTTAGGG + Intergenic
954819301 3:53311708-53311730 GTGGTCCTAGGAATTTGTTTAGG - Intronic
958072943 3:88637987-88638009 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
958257135 3:91338036-91338058 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
958998694 3:100936599-100936621 CTGGTCCTGGACTTTTTTTTTGG + Intronic
960109140 3:113828245-113828267 CTGGTACTGGCTATTGGTTTGGG - Intronic
961521903 3:127471961-127471983 CTGGTCCTGTCACTTATTTGAGG - Intergenic
962928107 3:140013400-140013422 CTTGTTCCGGCTCTTTGTTTTGG + Intronic
962948796 3:140199082-140199104 CTGGCCCTGACACTTTCTTGAGG - Intronic
963825297 3:149946441-149946463 CTGGTCCTGGCCTTTTTTGTTGG + Intronic
965892726 3:173534735-173534757 CTGGCTCTGCCACTTTGTATTGG - Intronic
966574205 3:181481147-181481169 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
967807401 3:193727980-193728002 TGGGTCCTGGCAATATGTTTGGG - Intergenic
967810167 3:193752952-193752974 GTGATCCCAGCACTTTGTTTGGG - Intergenic
971168248 4:24206253-24206275 CTGGTCCGGGTACTTGTTTTAGG - Intergenic
971647999 4:29233156-29233178 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
972100997 4:35416915-35416937 CTGGTCTTGGGATTTTTTTTGGG - Intergenic
973564236 4:52167834-52167856 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
975657061 4:76652159-76652181 CTGGTGTTGGCAGTTGGTTTTGG + Intronic
975790254 4:77941491-77941513 CTGGTCCTGGAATTTTTTGTTGG + Intronic
976326982 4:83782863-83782885 CAGGGCATGGCCCTTTGTTTAGG + Intergenic
977946783 4:102922926-102922948 CTGGTCCTGGACTTTTTTTTTGG - Intronic
978114715 4:105005505-105005527 CTGGTCCTTGGTCTTTGTCTGGG + Intergenic
978384791 4:108168310-108168332 CTGATCCTTGCACCTTCTTTTGG - Exonic
979664361 4:123294184-123294206 CTGGTGCTTGCACTTGCTTTTGG - Intronic
980811023 4:137880525-137880547 CTGTTGCTGGCCTTTTGTTTTGG - Intergenic
981151212 4:141381281-141381303 CTGGTCCTGGACGTTTTTTTTGG - Intergenic
981790663 4:148533087-148533109 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
981922291 4:150098605-150098627 GTGCACCTGTCACTTTGTTTTGG + Intronic
983182923 4:164669678-164669700 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
983571686 4:169215561-169215583 CTGGGCCTGGGGATTTGTTTTGG + Intronic
983853270 4:172609815-172609837 CTGGTCCTGGATTTTTTTTTTGG + Intronic
987193971 5:15506539-15506561 CTGGTCATGGTACTTTGTTATGG - Intronic
988966920 5:36428509-36428531 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
989624452 5:43415853-43415875 CTGGTTCTGGCACTATCTCTTGG + Intergenic
989995098 5:50819698-50819720 GTAATCCTAGCACTTTGTTTGGG - Intronic
991226996 5:64285220-64285242 CTGGTCATTATACTTTGTTTGGG + Intronic
991373888 5:65945498-65945520 ATGGTGCTGGTAATTTGTTTTGG + Intronic
991623248 5:68568743-68568765 CTGGTCCTGGACCTTTTTTTTGG - Intergenic
991677076 5:69098262-69098284 GTAATCCTAGCACTTTGTTTGGG + Intronic
993835470 5:92814710-92814732 CTGGTCCTGTTACTTTATCTTGG - Intergenic
993892073 5:93486614-93486636 TTGGTCCTGGGCTTTTGTTTTGG - Intergenic
994474705 5:100251881-100251903 CTGTTCCCGGCACTCTGTTATGG - Intergenic
994550418 5:101227724-101227746 CTGGTCCTGGAAGTTTTTGTTGG + Intergenic
996218973 5:120905050-120905072 CTGGTCCTGGGCTTTGGTTTTGG + Intergenic
996778225 5:127156170-127156192 CTGGTCCTGGGCCTTTTTTTTGG + Intergenic
997382748 5:133449297-133449319 CTGGGCCTGGTGCCTTGTTTGGG + Intronic
997613048 5:135228602-135228624 CTGGTGCTTGCAGTTTATTTGGG + Intronic
997675006 5:135706376-135706398 CTGGTCATTGCTGTTTGTTTTGG + Intergenic
997797540 5:136825639-136825661 CTGGTCCTGGCCTTTTTTTTTGG + Intergenic
997928599 5:138053661-138053683 CAGTGCCTGGCACTTTTTTTGGG - Intergenic
998704684 5:144745114-144745136 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
999881051 5:155864209-155864231 CTGGTCTGGTCACTTTGCTTTGG - Intergenic
1001852591 5:174982543-174982565 CAGGTTGTGGCACTTTGTTATGG - Intergenic
1002259976 5:177986053-177986075 CTCTTCCGGGCACTCTGTTTCGG - Intergenic
1002290874 5:178199902-178199924 CTGGGCCTGGCACTGAGATTTGG - Intergenic
1004662575 6:17723208-17723230 CTGGTCCTCCGACTTGGTTTTGG + Intergenic
1005405790 6:25486513-25486535 CTGGTATTGGCCCTATGTTTTGG + Intronic
1006073206 6:31511660-31511682 CTGGTGCTGCCACTTGTTTTGGG + Intergenic
1007231804 6:40353503-40353525 CTGGTCCAGGCCTTTTGTGTTGG + Intergenic
1007297899 6:40841573-40841595 CTGTTCCTGGTACTTTTCTTTGG + Intergenic
1007516450 6:42416791-42416813 CTGGTCCTGGGACTATTTTAAGG + Intronic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1008241220 6:49114595-49114617 CTGGTCCTGACTCTTTGGCTAGG + Intergenic
1008799060 6:55344056-55344078 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1009916434 6:70002478-70002500 CTGGTCCTGGGCTTTTTTTTTGG + Intronic
1010482476 6:76372049-76372071 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1010824483 6:80455815-80455837 CTTGACCTGCTACTTTGTTTGGG - Intergenic
1012678735 6:102152365-102152387 CTGTGCCTGGCACATTATTTGGG - Intergenic
1014431101 6:121371765-121371787 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1014590364 6:123258759-123258781 CTGGTCCTGGGCTTTTGTTTTGG + Intronic
1015131052 6:129809644-129809666 CTGGTCCTGGACTTTTTTTTGGG + Intergenic
1016111786 6:140233609-140233631 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1016141603 6:140618965-140618987 CTGGACCTGGAAATTTCTTTTGG + Intergenic
1016242183 6:141943652-141943674 CTGGTCCTGGGATTTTTTTTTGG - Intergenic
1016498832 6:144694512-144694534 CTGGTCCTGGGCTTTTTTTTGGG + Intronic
1016679333 6:146809890-146809912 TTGGTCTTGGCAATTTCTTTTGG + Intronic
1016679898 6:146816823-146816845 TTGGTCTTGGCAATTTCTTTTGG + Intergenic
1018867373 6:167756655-167756677 GTGGTTCTGGAACTTTGTTAGGG - Intergenic
1020088996 7:5327149-5327171 CTGGCCTTGGCCATTTGTTTTGG - Intronic
1020984203 7:15111910-15111932 AGGGTCCTGCCTCTTTGTTTTGG - Intergenic
1021129783 7:16897583-16897605 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
1021780143 7:24096538-24096560 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
1021967495 7:25935449-25935471 CTGGTACTGGGATTTTTTTTTGG - Intergenic
1024217836 7:47263025-47263047 CAGGTCCTGGCACTCTGTGTGGG - Intergenic
1024669007 7:51574411-51574433 CTGGTCCTGGGCTTTTATTTTGG + Intergenic
1024691577 7:51808813-51808835 CTGGGCTTGTCACTTTCTTTGGG + Intergenic
1027419389 7:78004913-78004935 CTGGCCCTGGCTCTTATTTTGGG - Intergenic
1029261919 7:99308557-99308579 CTGGTCCCGGGACCATGTTTTGG - Intergenic
1030154444 7:106439087-106439109 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1032625060 7:133582753-133582775 CTGGTCCTTGTGATTTGTTTCGG - Intronic
1034314816 7:150120605-150120627 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1035042140 7:155936636-155936658 CTGGTCCTGTCCTTTTCTTTGGG + Intergenic
1036139552 8:6194589-6194611 CTGGTCCTGGACTTTTTTTTTGG - Intergenic
1036502555 8:9326965-9326987 GTGGTACTGGCACTCCGTTTGGG + Intergenic
1037269476 8:17110717-17110739 CTGTACCTGGCAATTTTTTTGGG + Intronic
1037544807 8:19908830-19908852 CTGGTCCTGGATTTTTTTTTTGG + Intronic
1037719983 8:21434864-21434886 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1038082986 8:24161164-24161186 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1038206736 8:25474399-25474421 CTGGTCCTGGGCTTTTCTTTTGG + Intronic
1041160065 8:55031818-55031840 CTGGTCCTGGGCTTTTCTTTGGG - Intergenic
1042687191 8:71455276-71455298 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1044602163 8:94016350-94016372 CTGGTGCTTTCATTTTGTTTAGG - Intergenic
1045312357 8:101014147-101014169 CTTTTGCTGCCACTTTGTTTGGG + Intergenic
1045389738 8:101703659-101703681 CTGCTCCTGGCACTGTGGCTTGG - Intronic
1047200996 8:122767554-122767576 TTGTTCCTGGTTCTTTGTTTTGG - Intergenic
1047273901 8:123390236-123390258 GTAATCCTAGCACTTTGTTTGGG - Intronic
1047309311 8:123678193-123678215 CTGGCCCTGGTACTTTATGTGGG + Intergenic
1048232276 8:132655270-132655292 CTGGTCCTGGACTTTTCTTTGGG - Intronic
1051571153 9:18560628-18560650 CTGGTCCTGGGTTTTTTTTTTGG + Intronic
1051615534 9:19002262-19002284 CTGGTCCTGGACTTTTTTTTTGG - Intronic
1051946444 9:22574971-22574993 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1052392131 9:27892684-27892706 CTGCTGCTCTCACTTTGTTTAGG + Intergenic
1052638422 9:31132441-31132463 CTGGTCCTGGACTTTTTTTTTGG + Intergenic
1056536252 9:87530230-87530252 CTGAGCCTGCCACTTTGATTTGG + Intronic
1056952295 9:91051495-91051517 GTGGTCCTGGGATTTTGTTTTGG - Intergenic
1058372446 9:104285435-104285457 CTGTTACTGGCACATTGTATAGG - Intergenic
1058819551 9:108716968-108716990 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1186444124 X:9611666-9611688 CTGGCTCAGGCATTTTGTTTGGG + Intronic
1189574892 X:42341468-42341490 CTGGTCTTTGCATTTTGGTTTGG + Intergenic
1189873337 X:45407125-45407147 CTGGTCCTGGGCTTTTTTTTTGG - Intergenic
1193634257 X:83928815-83928837 CTGCTCCTGGGATTTTTTTTTGG - Intergenic
1195198559 X:102523460-102523482 CTGGTCCTGGGGTTTTTTTTTGG - Intergenic
1198961965 X:142193035-142193057 CTAGTCCTTGCACTGTGTTCAGG + Intergenic
1199253468 X:145691662-145691684 CTGGTCCTGGGCTTTTTTTTTGG + Intergenic
1199584677 X:149401888-149401910 CTGGGCCTGGGCCTTTGTGTGGG + Intergenic
1200604655 Y:5248095-5248117 CTGGTCCTGGGCTTTTTTTTTGG - Intronic
1200757169 Y:7000901-7000923 CTGGCTCAGGCATTTTGTTTGGG + Intronic