ID: 1066700553

View in Genome Browser
Species Human (GRCh38)
Location 10:38123122-38123144
Sequence CAGGGCAAAGAGAGGGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1211
Summary {0: 1, 1: 0, 2: 7, 3: 82, 4: 1121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066700543_1066700553 23 Left 1066700543 10:38123076-38123098 CCATGGTGGAAGGCAAAAGGGGA 0: 3
1: 10
2: 70
3: 219
4: 618
Right 1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG 0: 1
1: 0
2: 7
3: 82
4: 1121
1066700539_1066700553 27 Left 1066700539 10:38123072-38123094 CCAACCATGGTGGAAGGCAAAAG 0: 1
1: 14
2: 122
3: 366
4: 1159
Right 1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG 0: 1
1: 0
2: 7
3: 82
4: 1121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066700553 Original CRISPR CAGGGCAAAGAGAGGGGGGA AGG Exonic
900175242 1:1288622-1288644 CGGGGCAGAGACACGGGGGACGG - Intronic
900175526 1:1289818-1289840 CGGGGCAGAGACACGGGGGACGG - Intronic
900423136 1:2564360-2564382 CAAGGAAAGGAGAGGGGGTAGGG - Intronic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
900532623 1:3162187-3162209 CTGGGCACAGAGAGGGGTGATGG - Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900732606 1:4272104-4272126 CAGGGCAAAGGAATGAGGGAGGG - Intergenic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
901457675 1:9372677-9372699 CAGAGCAGAGAGAGCTGGGAGGG - Intergenic
901671517 1:10858797-10858819 CAGGGCGAAGGGAGAGGGAAAGG + Intergenic
901732320 1:11289114-11289136 CAAGGCAGAGAGACGTGGGATGG + Intronic
901770228 1:11526443-11526465 CAAGGCTCAGAGAGGGAGGAAGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902126516 1:14217110-14217132 AAGAGCAAAGAGAGAGGGAAAGG - Intergenic
902288105 1:15419518-15419540 CAGGAAAAAGAGAGGGGCCAGGG + Intronic
902649631 1:17828228-17828250 CAGGGAAAAGAGTGGGGGCCTGG + Intergenic
902730381 1:18365076-18365098 AAGGGAAAAGAGTGGGGTGAGGG + Intronic
902833570 1:19033305-19033327 CAGGGCAAGGGCAGAGGGGAGGG - Intergenic
903049217 1:20588596-20588618 TAGGGCAAAGAGAAGTTGGAAGG + Intergenic
903257502 1:22112718-22112740 CAGGGAAAGGGGTGGGGGGAGGG + Intergenic
903331618 1:22599782-22599804 GAGGGAAAAGAAAGGAGGGAAGG + Intronic
903365848 1:22805088-22805110 GGGGGCAAGGAGAGGGGGCAAGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
904557401 1:31373988-31374010 CAGGCCAAAGAAAGGGCGGCAGG - Intronic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
904937706 1:34143445-34143467 CGGGGCAAGGAGAGGGGTTATGG - Intronic
905105960 1:35563745-35563767 CCTGGAAAAGAAAGGGGGGAAGG - Exonic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905902396 1:41590218-41590240 CTGGGCAAAGAGAGAGGCCAAGG + Intronic
906140453 1:43531135-43531157 GAGGGCAAGGAGAGCGGGGAAGG - Intronic
906170769 1:43723090-43723112 GAGGGAAGAGAGAGAGGGGAGGG - Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907183640 1:52591927-52591949 GAGGCCAAAGAGAGGAGGAAGGG + Intergenic
907460231 1:54601450-54601472 CAGGGCAGAGAGGGAGGGGAGGG - Intronic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908793100 1:67802657-67802679 CAGGGCAAAGAGAGGTAGCCTGG - Intronic
908862728 1:68507898-68507920 GAGGGGAAAGAGAGAGGGTATGG + Intergenic
908975174 1:69888391-69888413 CAAGTCAAAGAAAGGGGTGACGG - Intronic
908992920 1:70115416-70115438 CCTGGCAAATAGAGCGGGGAAGG - Intronic
909036968 1:70604404-70604426 CAGGGCACAGGGATGGTGGAGGG - Intergenic
909412995 1:75376055-75376077 CAAGTCAAAGAAAGGGGTGACGG + Intronic
909993370 1:82250274-82250296 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910108964 1:83661581-83661603 GAGGGCAGAGAGAGTGAGGACGG - Intergenic
910591710 1:88933379-88933401 AAGGGAAAAGAGAGGAGGGAGGG + Intergenic
910736295 1:90461592-90461614 GAGGGCAGAGGGAGGGAGGAGGG - Intergenic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911200010 1:95034897-95034919 GAGGGCAAAGAGAGAGGAGGAGG - Intronic
911615729 1:100008651-100008673 CCAGGCAAAGAAAGGGGAGAAGG - Intronic
911990214 1:104686653-104686675 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
912180506 1:107213531-107213553 GAGGGCAATGGGAGGGGGAATGG - Intronic
912497596 1:110101559-110101581 CAGGGCAGAGCGAGGGTGAAAGG - Intergenic
912511051 1:110190379-110190401 GAGGGGAAAGAGGTGGGGGATGG - Intronic
912540535 1:110411545-110411567 CAGGGCAGAGAAAGCGGGGGTGG - Intergenic
912543007 1:110431119-110431141 CAGGGCAAAGAAGGTGGAGATGG - Intergenic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913246938 1:116878530-116878552 CAGGGTAAAGAGAGGAGCGCTGG + Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913305419 1:117425155-117425177 GAGGGCAAAGGGGGGAGGGAAGG + Intronic
913933964 1:125015482-125015504 CAAGTCAAAGAAAGGGGTGATGG + Intergenic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915058306 1:153157907-153157929 CAGGAGACAGAGAGGGGGGTGGG + Intergenic
915106936 1:153540658-153540680 CAGGGCAAAGAGAGAGTCCAGGG + Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915461796 1:156075000-156075022 CCGGGCCAAGAGAGGATGGAGGG - Exonic
915675231 1:157523725-157523747 CAGGGCAGAGAGTGGGGAGCAGG - Intronic
915820730 1:159021245-159021267 CAGGGGAAAGAGTGGGAGGGGGG - Intronic
915906630 1:159882844-159882866 CAGGGGAGAGAGAGTGGGAAAGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917256174 1:173118709-173118731 CAGGGAAAAGGGAGAGGGGAAGG + Intergenic
918187138 1:182137980-182138002 TAGGGCACAGAGAGGGTGGCAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919446127 1:197707946-197707968 CAAGTCAAAGAAAGGGGTGACGG + Intronic
919547686 1:198943973-198943995 CAGTGCAATGAGAGAGGGGTGGG - Intergenic
919829308 1:201529176-201529198 AGGGGGAAAGAGAGGCGGGAGGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920030974 1:203037214-203037236 CAGGGAAAAGAGAGAAGGGCCGG - Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920286778 1:204885366-204885388 CAGGGCAAAGGGGAGGGTGAAGG - Intronic
920430724 1:205917227-205917249 CAGGGCGAAGAGGGGAAGGATGG - Intronic
920674678 1:208030772-208030794 AAGAGCACAGAGAGGGGAGAGGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
921222530 1:212983392-212983414 GAGGGCAAAGAGAGGGAGAGAGG + Intronic
921326221 1:213988249-213988271 GAGGGGAGAGAGAGGCGGGAGGG - Exonic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
922209753 1:223478390-223478412 CAGGTCAATGAGGTGGGGGATGG - Intergenic
922287641 1:224183592-224183614 CTGGGCGAGGAGCGGGGGGAGGG + Intronic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922591966 1:226784219-226784241 CAGGGCACATAGAGGAGAGAAGG - Intergenic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923097722 1:230788732-230788754 CAGAGCATGGTGAGGGGGGAAGG + Intronic
923211659 1:231808922-231808944 GAGGGCACAGAGAGTCGGGAGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923621971 1:235587074-235587096 CAGGGCAAAGGGAGGAGGGGAGG + Intronic
924528844 1:244876354-244876376 CAGGGCTGAGAGAGAGGGAAGGG + Intergenic
1062922927 10:1293296-1293318 AAGGGGGAAGAGAGAGGGGAGGG + Intronic
1062995202 10:1859065-1859087 CAGGGCACAGAGGGGCGGGCTGG + Intergenic
1063522043 10:6749985-6750007 CAGAGGAAAGAGAGAAGGGAAGG - Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063893150 10:10651089-10651111 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064231182 10:13529856-13529878 GAGGGTAAAGAGTCGGGGGATGG + Intergenic
1064317931 10:14275510-14275532 CAGTGCAAAGAAAGGGAGAAAGG + Intronic
1064479506 10:15725410-15725432 CAGTGCAAAGGGTGGGGGGTGGG + Intergenic
1064580360 10:16787329-16787351 CAGGGCAGAGTGAGGAGGAAGGG - Intronic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066127242 10:32353277-32353299 AAGGGCAAAGAGAGAGAGAAAGG + Intronic
1066199011 10:33128057-33128079 GAGGGGAGAGGGAGGGGGGAAGG - Intergenic
1066213885 10:33267071-33267093 CAGGAGCAAGAGAGAGGGGAGGG - Intronic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066381450 10:34905516-34905538 CAGGGCAAAGAGAGGGCCTTGGG - Intergenic
1066687633 10:37995660-37995682 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067226316 10:44378543-44378565 AAGGGCAAAGACGTGGGGGAGGG - Intronic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067838538 10:49657003-49657025 CAGGGCAAAGAGAACAGGAAAGG + Intronic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1069487925 10:68836767-68836789 CAGGGCCAAGCTAGGTGGGAAGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1070276011 10:75007406-75007428 CAAGGAAAAGAAAGGGGTGAAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070763522 10:79042435-79042457 AAGGGAAGAGAGAGAGGGGAAGG + Intergenic
1070793893 10:79205778-79205800 AAGGGCACAGAGAGGGGAGGGGG + Intronic
1070810427 10:79294930-79294952 GAGGGGAGAGAGAGGGGGGGGGG + Intronic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071079090 10:81788708-81788730 CAGGGCAATGAGAGATGGGTTGG - Intergenic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1072400007 10:95087855-95087877 TAGGGGCAAGAGATGGGGGAGGG + Intergenic
1072522016 10:96237382-96237404 CAGAGCAAATATAGGGTGGAGGG - Intronic
1072623465 10:97096089-97096111 CAGGGCAGAGGCAGGGGGTAGGG - Intronic
1072623989 10:97099200-97099222 CAGGACGAAGAGAGGGGCCAGGG + Intronic
1072661256 10:97364864-97364886 AAAGGCAGAGAGAGAGGGGAGGG + Intronic
1072674617 10:97456504-97456526 CATGGGAAAGGGAGGAGGGAAGG - Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072980938 10:100096807-100096829 CAGGGCTAAGGGTGGGGGAAGGG + Intergenic
1073037494 10:100574591-100574613 GGGGGCAGAGAGAGGGGAGAGGG - Intergenic
1073203921 10:101758563-101758585 GAGGGCAAAGAGAGGTGGTTGGG - Intergenic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073709718 10:106022576-106022598 CGGAGCAAAGAGCGGGAGGACGG + Intergenic
1073837697 10:107463777-107463799 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1074235922 10:111584147-111584169 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075213018 10:120507747-120507769 AAGGGCTAAGAAAGGGGGCAGGG + Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075638610 10:124048466-124048488 CAGGGATAAGAGATGGGGGTAGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1075996634 10:126882097-126882119 CTAGGCAAAGAAAGGGGTGACGG + Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076109156 10:127848221-127848243 GGGGGGAGAGAGAGGGGGGAGGG + Intergenic
1076632236 10:131858081-131858103 CAGGGCAAGGGGCGGGGGGGCGG + Intergenic
1076632441 10:131859087-131859109 CAGGGCAAAGGGTGGGGCCATGG + Intergenic
1076684287 10:132190094-132190116 CAGGGCCATGAGAGAGGGGCTGG - Intronic
1076704282 10:132292897-132292919 CATGGGGAAGGGAGGGGGGAGGG - Intronic
1077286559 11:1768545-1768567 CAGGGCACAGAGAGGGGCAGGGG + Intergenic
1077358952 11:2131266-2131288 CAGGGCACAGACAGGGCCGAGGG + Intronic
1077463983 11:2724745-2724767 CAGGGCTCAGAGTTGGGGGAAGG + Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077515771 11:3001300-3001322 GAGGGCAAAGAAAGGGGAGTTGG - Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078185042 11:9044939-9044961 CAGGCCAAGGTGAGGGGTGAGGG - Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078436956 11:11333199-11333221 AAGGTGAGAGAGAGGGGGGAAGG + Intronic
1078563025 11:12389646-12389668 CAGGGCAACAAGAGAAGGGATGG + Intronic
1078824818 11:14919292-14919314 CAGGAGCAAGAGAGAGGGGAAGG - Intronic
1078827168 11:14940335-14940357 CAGGAGAGAGAGAGGGGGAAGGG + Intronic
1079010219 11:16822036-16822058 CAGGGAAATGAGAGGTGGGTGGG - Intronic
1079129521 11:17739106-17739128 CAGAGCAAAGACAGAGGGGGAGG - Intronic
1080202631 11:29690788-29690810 CAGGGCTAAGGGATGGGTGACGG - Intergenic
1080301689 11:30791629-30791651 CAGGGAAAAGAGATGGGGCTGGG + Intergenic
1080345675 11:31321428-31321450 CAAGTCAAAGAAAGGGGTGACGG - Intronic
1080458204 11:32433717-32433739 CAGGCGAAAGAGAGGTGGGCGGG + Intronic
1081513060 11:43795698-43795720 AAGGGAAAAGAGAGGAGGGTGGG + Intronic
1081545722 11:44070276-44070298 CAGTACACAGAGAGAGGGGAGGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081781090 11:45713376-45713398 GAGGGCAAAAGGAGGTGGGAGGG - Intergenic
1081881471 11:46456500-46456522 ATGGGCAAAGAGAGGGGTGAAGG + Intronic
1082132344 11:48506173-48506195 GAGGGGAAAGGGAGGGGGAAGGG - Intergenic
1082227462 11:49725514-49725536 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1082565807 11:54676793-54676815 GAGGGGAAAGGGAGGGGGAAGGG - Intergenic
1082642830 11:55685872-55685894 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082791574 11:57349602-57349624 CAGGGAAAGGAAAGAGGGGAGGG + Intronic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083264771 11:61541664-61541686 AAGGTCAGAGAGATGGGGGAGGG + Intronic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083343150 11:61971913-61971935 CAGGGCCAGGAGTGGCGGGAGGG + Intergenic
1083457844 11:62790923-62790945 CAGGGCAGAGATTGGGGTGAGGG + Intronic
1083627951 11:64081589-64081611 CAGGCCAAAGACAGGGAGCAAGG + Intronic
1083632688 11:64103955-64103977 CAGGGCACAGAGAGGGGATCCGG - Exonic
1083669589 11:64292434-64292456 CAGGGCGAGGCGAGAGGGGACGG + Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083826158 11:65205209-65205231 CAGGGGAAAGATAGGGGATAGGG + Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1083989851 11:66240300-66240322 GGGGGCAGAGAGAGGGTGGAGGG + Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084173245 11:67410528-67410550 CAGGGCCCAGGGAGGGGTGAGGG - Intronic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1086116446 11:83256546-83256568 AAGAGAAAAGAGAGGGGGGTAGG - Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088115277 11:106305451-106305473 ATGGGGAAAGAGAGGGGGAAGGG + Intergenic
1088182905 11:107132285-107132307 CAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088551631 11:111019364-111019386 CAGGTCAAAGACAGTGAGGAAGG - Intergenic
1088715397 11:112544379-112544401 AATGGCAATGAGAGGGAGGAAGG + Intergenic
1089009994 11:115124406-115124428 AATGGCAAAGGGAGGAGGGAAGG - Intergenic
1089052380 11:115557148-115557170 GAGGGCAAAGAAGGGAGGGAGGG - Intergenic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089345815 11:117791009-117791031 CAGGGCACAGGGAGTGGGGCAGG + Intronic
1089384370 11:118058365-118058387 CAGGGCCAGGAGTGTGGGGAAGG + Intergenic
1089448373 11:118572350-118572372 CAGGTCAAAGGGCGGGGGGGGGG - Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089615833 11:119694243-119694265 CAGGGAGAAGAGGGGTGGGAAGG + Intronic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090325848 11:125886084-125886106 CATGGCTCAGAGAGGGGGTATGG - Intronic
1090431958 11:126653679-126653701 CAGGGCAATGAGAAACGGGAGGG + Intronic
1090590589 11:128262704-128262726 CAGGACATAGGGAGGGGGGCTGG + Intergenic
1090703193 11:129314718-129314740 AAGGGGAAAGAGAGGGGGAGGGG - Intergenic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091385753 12:93500-93522 CAAGGCAGAGACAGAGGGGAAGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091918984 12:4289481-4289503 AAGGGAAGAGAGAGCGGGGAGGG - Intronic
1091925188 12:4341264-4341286 AATGACAAAGAGAGGGGGGGCGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092195882 12:6549536-6549558 CAGAGGAGAGAGAGGGGGAAGGG + Intronic
1092203748 12:6603271-6603293 CTGGGCAAGGATAGGTGGGAAGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092607125 12:10132795-10132817 CAGGGCAGAAAGACGGGGAAAGG - Intergenic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093145944 12:15567184-15567206 AAGGAAAATGAGAGGGGGGAAGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093639622 12:21511298-21511320 TAGGGCAAGGAAAGGGGGGAGGG + Intronic
1095387985 12:41672677-41672699 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1096042053 12:48526175-48526197 CAGGACAGAGGGAGGAGGGATGG - Exonic
1096065896 12:48740039-48740061 AAGGGCAAAGAGAGTGGTCAAGG - Intergenic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1096526244 12:52211950-52211972 CAGGGCTGAGGGAGGGGGAAGGG + Intergenic
1096638617 12:52976778-52976800 AAGGGCTGAGGGAGGGGGGATGG + Intergenic
1096675237 12:53222524-53222546 CAGGCCACAGGGAGGGGGGTTGG + Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096952092 12:55484240-55484262 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097262472 12:57727329-57727351 GAGGGAACAGAGCGGGGGGAGGG - Intronic
1097583486 12:61486892-61486914 GAGGGTAGAGAGTGGGGGGAGGG + Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1097661906 12:62439482-62439504 GAGGGCAAAGTGTGGGAGGAGGG - Intergenic
1097957795 12:65504322-65504344 CAGGACAAAGAAAGGAGAGAGGG + Intergenic
1098022661 12:66171757-66171779 CGGGGCAGAGAAAGAGGGGATGG - Intergenic
1098104748 12:67057296-67057318 TAGTGCAGAGAGAGCGGGGAGGG - Intergenic
1098844922 12:75523328-75523350 CTGGCCAAAGAAAGGGGTGACGG - Intergenic
1099141155 12:78977142-78977164 AAGGGCAAAGAAAGTGAGGAAGG + Intronic
1099258995 12:80352639-80352661 CAGGGAAAAGAGAAAGGGAAGGG - Intronic
1099643245 12:85318208-85318230 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1099643387 12:85319518-85319540 GAGGACAAAGAGGAGGGGGAGGG - Intergenic
1099685023 12:85874174-85874196 CAGGGCAAAGAGGGGAGGGATGG + Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100002552 12:89855049-89855071 CAGGAGCAAGAGAGGGGGGTAGG + Intergenic
1100012778 12:89973244-89973266 CAGGGAAAATGGAGGTGGGATGG + Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100250754 12:92820863-92820885 CAGGGCAGGGTGAGGGGTGAGGG - Intronic
1100553151 12:95666269-95666291 CAGGGGGAAGAGAGGGGATAAGG + Intronic
1100629363 12:96371955-96371977 CATGTTAAAAAGAGGGGGGACGG + Intronic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1101240439 12:102832956-102832978 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1101241883 12:102847141-102847163 AAGGGCCAAGTGAGGGTGGAAGG - Intronic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101446468 12:104740381-104740403 CAGGGCAGAGTGAGAGGGCAGGG - Intronic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101898336 12:108772159-108772181 CAGGGCACAGAAAGTGGGCAGGG + Intergenic
1102074363 12:110048254-110048276 CAGGGGATAGAGTGGGGAGATGG - Intronic
1102146245 12:110657142-110657164 CAGGGCTAGGGGAGGGGGAATGG + Intronic
1102543949 12:113641428-113641450 CAGAGCCAAGTGAGGGGTGAGGG - Intergenic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103763619 12:123267596-123267618 CAGGACACAGGGAGAGGGGATGG - Intronic
1103990358 12:124795075-124795097 CAGGGCATGGGGAGGGGAGAGGG - Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105069895 12:133227919-133227941 CTGGGCAGAGGGAGGGGGGCGGG + Exonic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1106019359 13:25899898-25899920 CAGGGGAAAGAGTGGAGGCAGGG + Intronic
1106573997 13:30957397-30957419 AAGGGCAAAGGGAGGGTTGAGGG + Intronic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108060776 13:46530904-46530926 TAGGGGAAAGAGACGGGGGGGGG + Intergenic
1108623065 13:52202841-52202863 GATGGCAAGGAGATGGGGGAAGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1109837928 13:67883203-67883225 CATGGCAAAGAGAGTGGCAAGGG - Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110117771 13:71841349-71841371 CAGGGAAGGGAGAGCGGGGAGGG + Intronic
1110260823 13:73483338-73483360 CAGGTCACAGAGAGGATGGAAGG - Intergenic
1110478755 13:75949419-75949441 CAGAGCAAAGAAAGCAGGGAAGG + Intergenic
1110863111 13:80365971-80365993 CATCTCAAAGTGAGGGGGGAAGG + Intergenic
1112257979 13:97852264-97852286 CAGGACCAAGACAGCGGGGAAGG + Intergenic
1112290341 13:98140584-98140606 GGGGGAAAAGAGAGGGGAGAAGG - Intergenic
1113437153 13:110302058-110302080 CAAGGCAAAGAGAGCTGGAAGGG + Intronic
1113474376 13:110569772-110569794 CAGGGAAAAGGGAGAGGGGGTGG + Intergenic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1113750488 13:112773496-112773518 GAGGGCAGGGAGAGTGGGGAAGG - Intronic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114486552 14:23066051-23066073 CACCCCACAGAGAGGGGGGAAGG + Intronic
1114537501 14:23432314-23432336 GAGAGCAAAGAGAGGGGTCAGGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115948062 14:38686097-38686119 TGGGGTAAAGGGAGGGGGGAGGG + Intergenic
1116092390 14:40326437-40326459 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1116153098 14:41167164-41167186 CAGGGGAAAGGGAGGGGAAAGGG - Intergenic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117543572 14:56771758-56771780 CAAGGCAGAAAAAGGGGGGAGGG + Intergenic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1118523288 14:66611787-66611809 CAGGGCAATGATAGGGAGAATGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118739319 14:68727597-68727619 CAGGTCAAAGTGTAGGGGGAAGG - Intronic
1119180216 14:72600332-72600354 CTGGGGACAGAGAGGAGGGAGGG - Intergenic
1119184843 14:72632828-72632850 GAGGGGAAAGGGAGAGGGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119385099 14:74253106-74253128 CAGGACAAAGTGAGTTGGGAGGG - Intronic
1119635848 14:76272783-76272805 AGAGGCAGAGAGAGGGGGGAGGG + Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120603192 14:86538072-86538094 CAGGTCCAAGAGAGGATGGAGGG - Intergenic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1121089940 14:91174230-91174252 CAGGGCAAGGTGTGGGGGAAGGG - Intronic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121434566 14:93910609-93910631 CCTGGCAAAAAGAGAGGGGAAGG + Intergenic
1121441730 14:93953917-93953939 CAGGGCTCAGAGAGGAGGCACGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121582166 14:95039378-95039400 CAGGGCATCGAGAGGGTAGAGGG + Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1122042108 14:98996067-98996089 CAGGGCCTAGAGTTGGGGGAGGG + Intergenic
1122117947 14:99536951-99536973 CAGGGCAGAGGGCTGGGGGAAGG + Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122293875 14:100694201-100694223 CAGGGCACACAGAGCGGGGGCGG + Intergenic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1202852408 14_GL000225v1_random:30010-30032 AAGGGCAGAGAGAGGCTGGAGGG - Intergenic
1202863456 14_GL000225v1_random:100150-100172 AAGGGCACAGAGAGGCGAGAGGG + Intergenic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1125180196 15:36873765-36873787 GAGGGTAAAGAGAGGTGGAAAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1126212870 15:46119764-46119786 CAGACCAAAGACAGAGGGGAGGG - Intergenic
1126280781 15:46947048-46947070 AAGGGTATAGAGAGGTGGGAAGG - Intergenic
1126352017 15:47753723-47753745 CAGGTAAAAGAGAGGAGGAAGGG + Intronic
1126457567 15:48880598-48880620 TAGGGCAAAGAGGTGGGGGTGGG + Intronic
1126690791 15:51287599-51287621 CAGGGCAGAGGGAGGGGGAAAGG - Intronic
1127309738 15:57742054-57742076 CAGGTCAAAAAGAGGGGTGGAGG - Intronic
1127370170 15:58331834-58331856 CAGGACAAACAGGGAGGGGAGGG - Intronic
1127399871 15:58574926-58574948 CAGGGCCAAGAGATGAGGGAGGG - Intergenic
1127804018 15:62502013-62502035 TAGGACAAAGAGAGCGAGGAAGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128233207 15:66049693-66049715 CAGAGCAGAGAGAGGGTGTAAGG - Intronic
1128343041 15:66835990-66836012 CAGGGGAAAGAGTGATGGGAAGG - Intergenic
1128380336 15:67107578-67107600 CAAGGCTCAGAGAGGCGGGAAGG - Intronic
1128739665 15:70074735-70074757 CAGGGCACAAGTAGGGGGGAGGG + Intronic
1128927193 15:71668457-71668479 CAGGTAAAAGGGAGGGGAGAAGG + Intronic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129669041 15:77596995-77597017 CAGGACAAAAGGAGGTGGGAGGG - Intergenic
1129699154 15:77757682-77757704 CAGGGCAAAGAGAGCCAGCAGGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1129987976 15:79935465-79935487 CAGGGCAACAAGTGGGGAGAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130212946 15:81942954-81942976 CAAGGCACAGTGAGGAGGGAGGG + Intergenic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1130650210 15:85758159-85758181 CAGGGCAGGGAGAGAGGGGGTGG + Intergenic
1130891512 15:88137564-88137586 GTCGGCAAAGAGAGAGGGGAAGG + Intronic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1130959888 15:88652530-88652552 GAGGGCAAAGGGGGAGGGGAAGG - Intronic
1131016834 15:89064924-89064946 GAGGGCAATGAGATGGGGCAGGG - Intergenic
1131331196 15:91500850-91500872 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1131833393 15:96368367-96368389 CTGGGCAAAGGGGGTGGGGAAGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132037172 15:98494082-98494104 CAGGCCAAAGTAAGGGGAGAAGG + Intronic
1132478709 16:154836-154858 CAGGACGAAGAGGGGAGGGATGG + Intronic
1132647264 16:1004862-1004884 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132647371 16:1005158-1005180 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1133030454 16:3008431-3008453 CTGGGAAAAGAGGTGGGGGAGGG - Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1133612161 16:7443426-7443448 GGGGGCAAAGAAAGAGGGGAGGG - Intronic
1133807811 16:9138679-9138701 GAAGGCAAAGAATGGGGGGAAGG - Intergenic
1133856331 16:9552606-9552628 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135158636 16:20074291-20074313 TAGGGCAAAGAACGGGGGAAGGG + Intergenic
1135164610 16:20128065-20128087 CAGGGGCCAGAGAGAGGGGAAGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135708712 16:24696862-24696884 CAAGGCAAAAAGAAGGGGAATGG - Intergenic
1135928566 16:26717179-26717201 GAGGGGACAGAGAGTGGGGAAGG - Intergenic
1136083836 16:27870582-27870604 CAGGGCTAGGAGGGCGGGGAAGG - Intronic
1136281172 16:29212322-29212344 CAGGGAACTGAGAGAGGGGAGGG + Intergenic
1136381505 16:29898184-29898206 CAGGGAGAAGGGAGAGGGGAGGG - Intronic
1136745691 16:32588144-32588166 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1137484595 16:48880982-48881004 CAGGGCAGAGAGAGAGGGAGAGG - Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138428606 16:56953029-56953051 CCAGGCTAAGAGATGGGGGATGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138489369 16:57367155-57367177 CAGGCCAGAGAGAGCTGGGAAGG - Intergenic
1138553108 16:57757815-57757837 CAGGGCAAAGAGTGGGCAGTGGG + Intergenic
1138762862 16:59565067-59565089 CGAGGCAAAGAAAGGGGTGAGGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140470773 16:75213103-75213125 AAGGGCAAAGAGAGACGCGAGGG - Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141155185 16:81592472-81592494 AAGGGCAAGGACAGGAGGGAGGG - Intronic
1141220521 16:82065293-82065315 GAGAGCTAAGAGAGGGGGAAAGG - Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141407592 16:83807827-83807849 CGGGGCATAGAGGGAGGGGAGGG + Exonic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141523998 16:84599635-84599657 AAGGCCAAAGAAAGGGGGAAGGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141841559 16:86577164-86577186 CATGTCAAAGAGATGAGGGAAGG - Intronic
1142085535 16:88178245-88178267 CAGGGAAATGAGAGAGGGGAGGG + Intergenic
1203047819 16_KI270728v1_random:847349-847371 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142910022 17:3081017-3081039 CAGGGGAGAGAGAGGGGCGGGGG + Intergenic
1143237095 17:5412277-5412299 CAGGGCAGAGAAAGAGGAGAGGG - Intronic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1143448793 17:7023590-7023612 AAAGGCAAACAGAGGAGGGAAGG + Intronic
1143476046 17:7204567-7204589 GATGGCAAAGAGTGGGGAGAGGG + Intronic
1143481342 17:7229217-7229239 CAGAGCAATGAGCGGGGAGACGG - Exonic
1143484201 17:7244053-7244075 CAGGGCAGAGAGGGGTGGGAGGG + Exonic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144327596 17:14196787-14196809 GAGGGCAAAGAGAGTGTGGGAGG - Intronic
1144459470 17:15446445-15446467 AAGGGCAATGGGAGTGGGGAGGG + Intronic
1144816963 17:18041079-18041101 AAGGGCAAAGGGAAGGGGAAAGG - Intronic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1145399149 17:22517179-22517201 TAGGGCAAAAAGAGAAGGGAAGG + Intergenic
1145984720 17:29037749-29037771 GGGGGCAAAGGGAGGGAGGATGG + Intronic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147403666 17:40195532-40195554 CAGGGCAACGGGAGGGGGCTGGG - Exonic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147968591 17:44207421-44207443 CAGGGCACAGTGGGAGGGGAGGG - Intronic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148559414 17:48597387-48597409 CAGGGCTGGGAGAGGGGGGTTGG + Intronic
1148735797 17:49864258-49864280 CAGGGCAGAGAGTGGGGTCAGGG + Intergenic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1148778695 17:50109913-50109935 CAAGGCACAGGGAGGTGGGAGGG + Intronic
1148805933 17:50264043-50264065 TAGGGAAAAGAGAGAGGGGGAGG + Intergenic
1149526802 17:57362690-57362712 GAGGGAAAAGAATGGGGGGAAGG - Intronic
1149552777 17:57552388-57552410 CAGGGCAGTGAGTGGGGGGCTGG - Intronic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1149764711 17:59265566-59265588 GAGGGCAAGGAGAGAGGGAATGG + Intronic
1150069694 17:62140279-62140301 CTGGGCAAAGAGACTGGAGAAGG - Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150444907 17:65221258-65221280 GAGGGCACAGAGTTGGGGGAGGG + Intronic
1150487438 17:65553709-65553731 CAGGGCAGAGAAAGGAGGCAGGG + Intronic
1150624089 17:66830289-66830311 GAGGGCTGAGTGAGGGGGGAAGG + Intergenic
1150711151 17:67531901-67531923 GATGGAAAAGAGAGAGGGGAGGG - Intronic
1151304677 17:73255606-73255628 CAGGGCTCAGAGAGGGGAAAAGG + Intronic
1151766429 17:76135652-76135674 CCGGGCAAAGCAAGGGGGGCGGG + Intergenic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152283912 17:79401540-79401562 CAGTGCAGAGGGAGAGGGGAGGG + Intronic
1152456049 17:80416772-80416794 CTGGGCACAGAGTGGGGGAAGGG - Intronic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152746128 17:82040181-82040203 CAGGGCACAGGGTGGGGGTAGGG - Intergenic
1203160511 17_GL000205v2_random:44808-44830 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1203191215 17_KI270729v1_random:191584-191606 CAAGTCAAAGAAAGGGGTGATGG + Intergenic
1153105578 18:1521988-1522010 CAAGTCAAAGAAAGGGGTGATGG - Intergenic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1155331043 18:24716593-24716615 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155959226 18:31979685-31979707 TAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1156027561 18:32672215-32672237 CAGGGCAATTAGAGGGGCTATGG - Intergenic
1156489234 18:37486482-37486504 CAAGGCCAAGAGAGTGGGGATGG + Intronic
1156768547 18:40689628-40689650 CAGGGCAGAAAGAGGAGGAAAGG - Intergenic
1157280977 18:46346120-46346142 CTGGGCAGAGAGAGAAGGGATGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157852166 18:51065311-51065333 AAGGGTAAAGGGAGGGGAGATGG - Intronic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1158333385 18:56387775-56387797 AGGGGCAAAGAGAGTAGGGAGGG + Intergenic
1158391892 18:57051188-57051210 CAGGGGATAGAGAGGAGGGAGGG - Intergenic
1158470078 18:57728453-57728475 GAGGGCAAAGAGAGGAAGGGAGG + Intronic
1158645066 18:59238638-59238660 CAAGGCAAAGAGAGGAGTAAAGG - Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159550627 18:69892442-69892464 AAGGGCAAGGAAAGTGGGGACGG - Intronic
1159625086 18:70683677-70683699 AATGTCAAAGAGAGGGAGGAAGG - Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159872684 18:73776222-73776244 AAGGGCAAAGAGAGGGTGAGAGG - Intergenic
1160391954 18:78540611-78540633 CAGAGCAGAGAGAGGGGCCAGGG + Intergenic
1160429584 18:78802224-78802246 CAGGAGAAAGGGATGGGGGAGGG + Intergenic
1160829788 19:1098388-1098410 CAGTGAAAAGAGGGGTGGGAGGG + Intergenic
1160888722 19:1365643-1365665 CAGTGCCAAGGGAGGGCGGAGGG - Intronic
1161286004 19:3468561-3468583 CAGGGCATACAGTGGGGGGTGGG + Intronic
1161357296 19:3826147-3826169 CGGGGCAGAGAAACGGGGGAAGG - Intronic
1161403753 19:4080827-4080849 AAGGGGAAAGGGAGAGGGGATGG + Intergenic
1161501034 19:4615815-4615837 CGAGGCGAAGAGAGGGAGGAGGG - Intergenic
1161730494 19:5957563-5957585 GGGGGCAAAGGGAGGAGGGAAGG - Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161793618 19:6374630-6374652 CAGGGCACAGGGTGGGCGGATGG - Intronic
1161973703 19:7597156-7597178 AAGGCCAGGGAGAGGGGGGATGG - Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162185149 19:8898881-8898903 CAGGGCAGAGTGAGGAGGGCAGG + Intronic
1162186338 19:8907730-8907752 CTGGGCAGAGTGAGGAGGGAAGG + Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162660677 19:12166390-12166412 CAGGGAAAAGAAATGGGGGTGGG + Intronic
1162697175 19:12485329-12485351 TAGAGCAAAGTGTGGGGGGAGGG - Intronic
1162782602 19:13014316-13014338 CAGGGCCCAGAGGCGGGGGAGGG - Intronic
1162875134 19:13615882-13615904 CTATGCAAAGATAGGGGGGAGGG - Intronic
1162876782 19:13626590-13626612 AAGGGGAAAGGGAAGGGGGAAGG + Intergenic
1162959926 19:14119620-14119642 CAGGGCACAGAGAGGGGGAGCGG + Exonic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163776136 19:19219008-19219030 CAGGGTAAAGAGACAGGGCAGGG - Exonic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164426058 19:28142713-28142735 GAGGGGAAAGAGGGGAGGGAGGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164704290 19:30308540-30308562 CAGGGCAGTGAGGGAGGGGATGG + Intronic
1164859778 19:31553826-31553848 CAGGGCAAAGTGAGGCTGCATGG + Intergenic
1164868152 19:31622148-31622170 CATTGGAAAGAGAGAGGGGATGG + Intergenic
1165096323 19:33411748-33411770 CACTGCAAAGAGCCGGGGGAGGG + Exonic
1165124127 19:33581986-33582008 AAGGGCAAAGAGAGGGTGAGAGG - Intergenic
1165489287 19:36114105-36114127 CTGGGCGAAGGGAGGAGGGAAGG - Intronic
1165492805 19:36134900-36134922 CAGGGCGAAGAGATGAGGGCAGG + Intergenic
1165610428 19:37146744-37146766 CAGGTCACATAGAGGGGGAAAGG - Intronic
1166075523 19:40411749-40411771 CAGGGGAAAGAGGGGTGGGGAGG + Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
1167252698 19:48409113-48409135 AAGGGCAAAGAGAGGAGTGAGGG + Intronic
1167598075 19:50437731-50437753 CTTGGCACAGAGAGGGGAGATGG + Intronic
1168298374 19:55388991-55389013 CAGCTCAAAGAGACAGGGGAGGG - Intronic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
925066823 2:934164-934186 CACGTCAAATAGAGGGGGGGTGG + Intergenic
925210762 2:2043660-2043682 CAGGGCAAGGAAGGGGGTGAAGG - Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926087332 2:10028672-10028694 GAGGGGAAAGGGAGGGGAGAAGG - Intergenic
926088015 2:10032297-10032319 GAGGGCAGAGAGAGTGGGGAGGG - Intergenic
926230709 2:11001883-11001905 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
927069139 2:19507606-19507628 CGGGGCAGAGAGAGTGGAGAAGG - Intergenic
927144526 2:20153917-20153939 GAAGGAAGAGAGAGGGGGGAAGG - Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928407990 2:31029606-31029628 AAGGGGAAAGAGAGGGGCGGAGG - Intronic
928857012 2:35814285-35814307 CAGAGAAAAGAGAGGAGAGAAGG - Intergenic
929440316 2:41961011-41961033 TTGGGCAAAGAGACTGGGGATGG - Intergenic
929441030 2:41965907-41965929 CAGAGGAGAGAGAGTGGGGATGG + Intergenic
929642532 2:43596046-43596068 CAGGGCAAAGGGAGGGAGAGAGG + Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930433078 2:51305375-51305397 GAGGGCAGAAAGAGGGGGGTGGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930606597 2:53499387-53499409 GAGAGCAAAGACAGGAGGGAAGG + Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931308712 2:61057883-61057905 CAGGGAGAAGAGAGGGGGTTTGG - Intergenic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932144616 2:69306809-69306831 CCGAGCAGAGAGAGCGGGGAGGG + Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932356334 2:71071386-71071408 CGGGGCAAGGTGAGGGGAGATGG - Intronic
932411073 2:71548203-71548225 CAGGGCAAAGACAGCAAGGAGGG - Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932491756 2:72127232-72127254 GAGGGAGAAGAGAGGGGGAAAGG - Intergenic
932563028 2:72888758-72888780 CAGGGGAAATAGAGGTGGCAGGG + Intronic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
934652386 2:96099921-96099943 AAGGACAAAGAGGAGGGGGAGGG + Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
935024331 2:99261716-99261738 CAGTGCAAAGAGAGGAAGCAGGG + Intronic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
935733804 2:106089829-106089851 CAGAGCAAAGAGTGGGGGTAGGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
935923101 2:108036120-108036142 GAGGGCCAAGAGTGGGAGGAGGG - Intergenic
936462747 2:112724400-112724422 CAGGTCAAAGGGAGGGGTGCTGG + Intronic
936518194 2:113195805-113195827 CAGTCCAAAGACAGGGGAGAGGG - Intronic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937758801 2:125574650-125574672 CAGGGCCATGAGAGGCTGGAGGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
938664642 2:133521991-133522013 CAGGGCAAGGTGAGGTGGAAAGG - Intronic
938666816 2:133547096-133547118 CAAGGCAAAGAAAGGGGTGACGG + Intronic
938708571 2:133955605-133955627 TAGGGCAAGGTAAGGGGGGAGGG - Intergenic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939298080 2:140295862-140295884 TGGGGCAAAGAGAGGGAGCATGG + Intronic
939589875 2:144051808-144051830 AAGGGCAAAGAAAAGGCGGAGGG + Intronic
940242537 2:151578629-151578651 CAGGGCAAGGGAAGGAGGGAAGG + Intronic
940453881 2:153872448-153872470 CAGGGCAAAGGCAGGGGCGCGGG + Intronic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941987953 2:171526414-171526436 GAGGGGAGAGAGAGGGGGAAAGG - Intronic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
943477649 2:188378642-188378664 GAGGCAAAAGAGAGAGGGGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
944486811 2:200215461-200215483 CAAGCCAAATAGAGGGAGGAAGG - Intergenic
945033571 2:205685855-205685877 GAGGGCGGAGAGAGGCGGGAAGG + Intronic
945236999 2:207640254-207640276 CAGGAACAAGAGAGGGGGGCAGG - Intergenic
945528095 2:210913958-210913980 GAGGGCAAAGGGAGGAGAGAAGG - Intergenic
945554546 2:211262689-211262711 CAGAGAAAAGAGAGGAGAGAGGG - Intergenic
945794501 2:214345418-214345440 TAAGGCAAAGACAGTGGGGAAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946188111 2:217992666-217992688 CAGGGGAGAGAGAGGGGTGCGGG + Intronic
946468268 2:219932050-219932072 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947587082 2:231362997-231363019 CAGGGCACAGAGAGCGTGCAGGG + Intronic
947616897 2:231563637-231563659 CAGGGGCAAGAGAGTGGGGGTGG - Intergenic
947661201 2:231869972-231869994 GAGGGAAAAGGAAGGGGGGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
948234688 2:236379354-236379376 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234704 2:236379398-236379420 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234720 2:236379442-236379464 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234736 2:236379486-236379508 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234752 2:236379530-236379552 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234768 2:236379574-236379596 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234784 2:236379618-236379640 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234800 2:236379662-236379684 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234816 2:236379706-236379728 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234832 2:236379750-236379772 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234848 2:236379794-236379816 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234862 2:236379838-236379860 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234878 2:236379882-236379904 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168849722 20:968152-968174 CAGGGCAGAAGGAGGGGGAAAGG + Intronic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169801238 20:9514729-9514751 CGGGGGACAGAGAAGGGGGAGGG - Exonic
1170067277 20:12326572-12326594 CAGGGCTAAGGAAGTGGGGAGGG + Intergenic
1170545980 20:17436235-17436257 CAGGGGACAGAGAGAGGGGCAGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171345293 20:24461440-24461462 CAGCCCACAGAGAGGGGGGCAGG + Intergenic
1171971450 20:31567440-31567462 GAGGGCAAACAGTGGGGGCAGGG - Intronic
1172056866 20:32160122-32160144 CAGGGCCAGGAGGCGGGGGAGGG + Intronic
1172117432 20:32581319-32581341 CAGGGCAGAGAGAGGGCGAGGGG - Intronic
1172448039 20:35003284-35003306 CTGGGCAAAGAGGGAGGGGCTGG + Intronic
1172599420 20:36173626-36173648 CAGGGCAAAGGGAGGAGGAAGGG - Intronic
1172645548 20:36467064-36467086 CAGGGCCGAGAGAAGGGGGGGGG - Intronic
1172692129 20:36797281-36797303 CTGGGCTAAGTGAGGGGGTAGGG - Intronic
1172700595 20:36851555-36851577 CAGGGCAGAGATGGGGGGCAGGG - Intronic
1173164811 20:40680412-40680434 CCAGGCAAAGAGATGGGTGATGG - Intergenic
1173556873 20:43972668-43972690 CAGGGCAAAGAGGGAGGCGGGGG + Intronic
1173753791 20:45497366-45497388 CATGGCAAAGAGAGAGGGTGGGG + Intergenic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174197813 20:48785936-48785958 CAGGGCAGAAAGAGCCGGGATGG + Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175031423 20:55958406-55958428 TAGGTCAAAGTGAGGGTGGAGGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175766112 20:61594114-61594136 CAGGGCAAAGAGGGAGGGGGAGG + Intronic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1175998533 20:62821887-62821909 AAGGGAAAAGGGAGAGGGGAAGG - Intronic
1176054116 20:63135186-63135208 CAGGGCCCAGAGAGGAGGCAGGG + Intergenic
1176113840 20:63422543-63422565 CATGGGGAAGAGACGGGGGAGGG + Intronic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1178258856 21:31080174-31080196 CAGGGTAGAGAGAGGTGGGCTGG + Intergenic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179122028 21:38556713-38556735 GAGGACACAGAGTGGGGGGAAGG + Intronic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179446291 21:41433215-41433237 CAGGTCTAAGAGTGGGAGGAGGG - Intronic
1179809895 21:43864359-43864381 CAGGTGCAAGGGAGGGGGGACGG + Intergenic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180194599 21:46185035-46185057 CAGGGCAGAGAGAGAAGCGAGGG + Intergenic
1180864174 22:19106343-19106365 AAGGGCAAAGAGAGGATGGGAGG + Intronic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181811392 22:25405546-25405568 CAGGGCGAGGAGCGCGGGGAGGG - Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182415853 22:30221108-30221130 GAGGGCAAAGGGAGGGCAGACGG + Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1182495736 22:30706062-30706084 AAGGGGAAAGAGAGGGGAAATGG + Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1183473038 22:38019587-38019609 CAAGGCAGAGAGAGGGAGGGCGG + Intronic
1183485702 22:38086634-38086656 CAGGGCAGAGAGAGGGGCTCAGG + Intronic
1183740314 22:39665225-39665247 CTGGGCACAGTGAGGGGTGAGGG + Intronic
1183742499 22:39676669-39676691 CTGGCCATAGAGAGGAGGGAAGG - Intronic
1184104713 22:42360669-42360691 GAGGGCAAAGACTGGGGGAAGGG + Intergenic
1184219901 22:43093248-43093270 CAGGGCGGGGGGAGGGGGGAGGG + Intergenic
1184400603 22:44271662-44271684 CAGGGCAGAGCGAGTGGAGAAGG - Intronic
1184482938 22:44758702-44758724 CAGGGCAAAGGCAGTGGGGTGGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184533536 22:45071566-45071588 GAGGGCCAAGAGAGGAGGCAGGG + Intergenic
1184956400 22:47889712-47889734 CAGGAGAAAGAGAGAGGGGGAGG - Intergenic
1184971855 22:48028132-48028154 CAGGGCACAGAGGGAGTGGAAGG + Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185110251 22:48896522-48896544 CGGGGCAGAGCGAGGGGGAATGG + Intergenic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185359486 22:50397004-50397026 TGGGGCAAGGAGAGTGGGGAGGG + Intronic
949201678 3:1387780-1387802 CAAGTCAAAGAAAGGGGTGACGG + Intronic
949614612 3:5739605-5739627 GAGGGAAAGGAGAGAGGGGAGGG - Intergenic
949698711 3:6730337-6730359 CAGGAGGAAGAGAGAGGGGAGGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
949960015 3:9304295-9304317 CTGGGGAAAGAAAGGAGGGAGGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950429519 3:12942894-12942916 CAGGCCAAGGAGAGGGGCCATGG + Intronic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
951198846 3:19855280-19855302 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
951381474 3:21988942-21988964 CAAGTCAAAGAAAGGGGTGATGG - Intronic
951658630 3:25037354-25037376 CAGGGCAAACATGGGGTGGAGGG + Intergenic
952635047 3:35519028-35519050 CAGGGTATAGAGGGGAGGGAAGG - Intergenic
952971170 3:38651130-38651152 GAGGGCAAAGAGGGGGGTGGGGG + Intergenic
952993286 3:38852168-38852190 AAGGGCAATGAGAGGAAGGAGGG + Intronic
953196550 3:40739516-40739538 CAAGGCAAAGAGGAGAGGGAAGG - Intergenic
953458823 3:43065002-43065024 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953860648 3:46541506-46541528 AAGGGCAAAGAGAAAGGGAAAGG + Intronic
953876550 3:46670006-46670028 CAGGGCAAAGCGTAGGGAGAGGG - Exonic
954130711 3:48559334-48559356 CAGGGCCATGGGAGGGGAGATGG - Intronic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
954526909 3:51280017-51280039 GAGGGCAAGGAGAGAAGGGAGGG - Intronic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
955061679 3:55497832-55497854 AAGAGCCAAGAGAGGTGGGAAGG + Intergenic
955843456 3:63136500-63136522 CGAGGCAAAGAAAGGGGTGACGG + Intergenic
955973178 3:64456229-64456251 CAAGGCAGAGAGAGGGATGAAGG + Intergenic
956289690 3:67648402-67648424 AAGGGCAAAAAGATGGGGAAAGG + Intronic
956328792 3:68082087-68082109 CAAGTCAAAGAAAGGGGTGACGG - Intronic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
956707957 3:72015628-72015650 CAGGGCAGAAAGAGGGGCGGAGG - Intergenic
957134890 3:76273962-76273984 AAGGGCAAAGAGAGGGTGAAAGG + Intronic
957980913 3:87509576-87509598 CGGGGCGCAGAGAGGGGTGAGGG - Intergenic
959702831 3:109314676-109314698 GAGGGCAAAAAGAGGAGGAAAGG - Intronic
959808870 3:110592698-110592720 CAGAGCAAAGGGCCGGGGGATGG - Intergenic
959974435 3:112442532-112442554 GAGGGCAGAGAGAGGGAGGGGGG + Intergenic
960115245 3:113886149-113886171 CAGGGCAGAGAGGGGTGGGAGGG - Intronic
960196664 3:114776839-114776861 CAGGGCAAAGAGAGTGCACAAGG + Intronic
960318793 3:116209173-116209195 CAAGTCAAAGAAAGGGGTGACGG - Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961001532 3:123377378-123377400 CTGGGCAAAGAAAGGTGGGGTGG - Intronic
961366775 3:126405138-126405160 CAGGGCTAGGGGAGGGGGAATGG - Intronic
961492484 3:127265171-127265193 CAGGGCACAGAGGGAGGGGCAGG + Intergenic
962070464 3:132028510-132028532 AAGGGGTAAGAGATGGGGGAAGG + Intronic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
962649890 3:137477822-137477844 CAGGGCAATGGGAGGGGAGGGGG + Intergenic
963246407 3:143067703-143067725 AAGGGAAAGGAGAGGAGGGAGGG - Intergenic
963353840 3:144185428-144185450 CAGGGCACTGAGAGAGGAGATGG - Intergenic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964126755 3:153241534-153241556 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
964244373 3:154633601-154633623 CACGGCAAGGGGATGGGGGAGGG + Intergenic
964286626 3:155125191-155125213 CAAGTCAAAGAAAGGGGTGACGG - Intronic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965349811 3:167598543-167598565 CAGGAGAAAGAGAGTGGGGTGGG - Intronic
965524627 3:169702694-169702716 CAAGGGAAAGAGAGGTGTGATGG - Intergenic
965528548 3:169747334-169747356 CAGAGCAAAGAAGGTGGGGAGGG + Intergenic
965787650 3:172352876-172352898 CAGGACACAGAGAGTGGAGACGG - Exonic
967229642 3:187325264-187325286 CAGAGAAAAGAGGGGGTGGAAGG + Intergenic
967330131 3:188282049-188282071 AAGGGAAAAGAGAGGAGGGGAGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968520284 4:1031988-1032010 CAGGGCCAAGAGAGTGGGCACGG + Intergenic
968733225 4:2281505-2281527 CATGGGCAAGAGAGAGGGGAAGG + Intronic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
968833021 4:2942942-2942964 CCGGGCCAAGCGAGAGGGGAAGG + Intronic
968912972 4:3485202-3485224 CAGGGCATGGGGAGGAGGGAGGG - Intronic
969056290 4:4404892-4404914 AAGGGCAAGGAGAGAGGGCAGGG + Intronic
969095450 4:4729236-4729258 CAGGGCAATGAGACAGGGGTAGG - Intergenic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969339169 4:6529625-6529647 CAGGGAAGAGGGATGGGGGATGG - Intronic
969491088 4:7499654-7499676 TGGGGCAAAATGAGGGGGGATGG - Intronic
969608027 4:8211951-8211973 CAGGGGACAGACAGGAGGGAGGG + Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970047031 4:11866071-11866093 GAGGGCGAAGGGAGGGAGGAGGG + Intergenic
970347520 4:15167877-15167899 CAGGGCAGAGAGAGAAGAGAGGG - Intergenic
970504330 4:16711606-16711628 AAGGGCAAAGAGTGGAGGCAGGG + Intronic
970756603 4:19434599-19434621 CAGGGTAAAATGAGGGGTGAGGG - Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971454980 4:26835708-26835730 CAGGGCAAAGAATAGGGTGAAGG - Intergenic
971493111 4:27235327-27235349 CAGAGAAAAGACAGTGGGGATGG - Intergenic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
972429199 4:38964299-38964321 CAGGTCATAGGGAGGGGGTATGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972659740 4:41104627-41104649 CAGGGCCAAGGGTGGGAGGAGGG - Intronic
973542395 4:51947313-51947335 CAGGACCAAGAGAGTGAGGAGGG - Intergenic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
973604285 4:52571204-52571226 CTGGGCAAGGAGAGAGGGCAGGG - Intergenic
974088871 4:57289672-57289694 CAGGCCAAGGAGAGGGGGCTCGG + Intergenic
974222273 4:58990971-58990993 GAGGGGAAAGAGAGAGGGTATGG - Intergenic
974846648 4:67359111-67359133 CAGGGCAAGGAATGGGGGAAAGG - Intergenic
976186722 4:82449506-82449528 CAGGAGCAAGAGAGTGGGGAGGG + Intronic
976371854 4:84299009-84299031 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
978102337 4:104857551-104857573 CAGGGGAAAGATAAGGGGGTGGG + Intergenic
978501997 4:109419716-109419738 AAGGGGTAAGAGAGGAGGGAAGG - Intergenic
978777273 4:112516368-112516390 CAGGGCCAAGGGAGGGGGAAAGG - Intergenic
978968108 4:114767819-114767841 CAGGGCAGAGGGTGGGAGGAGGG + Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
980010475 4:127589162-127589184 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
980021395 4:127714415-127714437 CAGGGGCCAGAGAGAGGGGAAGG - Intronic
980130162 4:128810719-128810741 AAGGGCAGTGAGAGGGGGGTGGG + Intronic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980448801 4:132944640-132944662 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981554730 4:145980557-145980579 CAGTGCAATGACAGAGGGGAAGG + Intergenic
981720635 4:147797929-147797951 CAGGACAAAGAGGAGAGGGATGG - Intronic
981993522 4:150953375-150953397 CCGTGCAAAGAGGGGGGGGAGGG - Intronic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982688448 4:158521138-158521160 CAGGGCATAGTGAGGGGTGTAGG - Intronic
982710691 4:158755956-158755978 CAGGCCAGAGAGGAGGGGGAGGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983441419 4:167791246-167791268 CAGGGCAAAGAGAGAGAGAGAGG - Intergenic
983600476 4:169521280-169521302 CAAGTCAAAGAAAGGGGTGACGG - Intronic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984775507 4:183478249-183478271 GAGGGAAAAGAAAGGAGGGAAGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985273609 4:188216839-188216861 TAGAGCAAAGAAAGGAGGGAGGG - Intergenic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
985404999 4:189629047-189629069 CAGGGGAGAGGGATGGGGGAAGG + Intergenic
985654997 5:1126629-1126651 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
987015608 5:13815678-13815700 AAGGGCAAAAAGAGGAGGAAGGG + Intronic
987261217 5:16205357-16205379 CACGGCAAGGAGAGAAGGGAGGG + Intergenic
987958104 5:24766130-24766152 CTGGGCTAGGGGAGGGGGGAGGG + Intergenic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
989705531 5:44325722-44325744 CAGGGCCTGGGGAGGGGGGAGGG + Intronic
990846735 5:60148943-60148965 CAGGGCAAAGTAAAGGGAGATGG + Intronic
991669677 5:69035546-69035568 AAGGACAAAGAGATTGGGGAGGG + Intergenic
992056738 5:72997754-72997776 CAGGGCAGAGAGGGGTTGGAGGG - Intronic
992457502 5:76929233-76929255 CATGGCAGAGAGAAGGGTGAAGG + Intergenic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993094227 5:83463570-83463592 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
993685253 5:90929405-90929427 CAAGTCAAAGAAAGGGGTGACGG - Intronic
994117690 5:96079242-96079264 CAGGACAAAGAGTGTGGGTAGGG - Intergenic
994324317 5:98431774-98431796 GGGGGCAAAGAGATGGGGGTAGG - Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995361441 5:111302463-111302485 CAAGTCAAAGAAAGGGGTGACGG + Intronic
996012687 5:118498762-118498784 CAGGGCAATCAGACGGGAGAAGG - Intergenic
996017468 5:118556662-118556684 GAGGGCAAAAGGAGGGCGGAAGG - Intergenic
996387522 5:122925057-122925079 GAGGGAAAAGGGAGAGGGGAGGG - Intronic
997578040 5:134997767-134997789 AAGGTCAAAGAGAGAGGGGTAGG - Intronic
997721675 5:136082811-136082833 CAGAGCAAAGAAAGAGGAGAGGG - Intergenic
997826120 5:137108479-137108501 AAGGGAAAAGAGTGGTGGGAGGG - Intronic
997964077 5:138344249-138344271 GAGGGCAAACAGGGTGGGGAAGG - Intronic
998107151 5:139475888-139475910 CCGGGCAAAGGAAGGGGAGAAGG + Intronic
998382020 5:141732379-141732401 CAGAGAAGAGAGAGGGGAGAAGG - Intergenic
999154802 5:149450559-149450581 CTGGGCACAGAGAGGAGAGAAGG + Intergenic
999480183 5:151940962-151940984 CAGGGCAAAGGGGCGGGGGTGGG + Intergenic
1000343285 5:160294204-160294226 CGGGGCAGAGAGAGGAAGGAGGG - Intronic
1000761534 5:165231279-165231301 CAGGAATAAGAGAGGGGGCATGG + Intergenic
1001106080 5:168855807-168855829 TTAGGCAAAGAGAGTGGGGACGG - Intronic
1001456191 5:171862121-171862143 CAGGGGGAAGGGAGGGGGCAGGG - Exonic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1002046793 5:176545999-176546021 AAGGGCAGGGAGAGGGGGCAGGG + Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003393304 6:5731845-5731867 CAGGACACTGAGAGGGGGAAGGG - Intronic
1003411355 6:5865614-5865636 GAGGGTAATGAGAGTGGGGAAGG + Intergenic
1003643932 6:7899051-7899073 GAGGGCAAAGGTCGGGGGGATGG + Intronic
1003946021 6:11076757-11076779 AAGGGCACAGGGAGGGTGGAAGG - Intergenic
1004106143 6:12668910-12668932 CTGGGCACAGAGACTGGGGAGGG - Intergenic
1004299026 6:14440468-14440490 CAGGGCACTGAAAGTGGGGAGGG + Intergenic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004582684 6:16969711-16969733 GAAAGAAAAGAGAGGGGGGAGGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004748668 6:18538573-18538595 CAAGGCAAAGAAAGGGAGGGAGG - Intergenic
1004855373 6:19744140-19744162 CAGGGCAAAGAAAAGTGGGTAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004987581 6:21100106-21100128 CAGGGGACAGAGAGTGGGGGTGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005755581 6:28922989-28923011 CAGAGAAAAGAGAGTGGGGGTGG + Intronic
1005948824 6:30616241-30616263 GCAGGCAAAGAGAGGGTGGAGGG - Intronic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006358516 6:33574449-33574471 CGGGGCACAGAGAGGGCAGAGGG + Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006514746 6:34539566-34539588 CAGGGCAAGGAGAGGGGGTTGGG + Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006902534 6:37512436-37512458 CAGCTCAAAGAGAGGAGGCAGGG - Intergenic
1007073196 6:39050855-39050877 CAGGGAAGAGAAAGGGGTGAAGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007340088 6:41185938-41185960 CAGGGCCAAGGGAGGGGGACAGG - Intergenic
1007816340 6:44528088-44528110 CAGGGCTAAGGGCTGGGGGAAGG - Intergenic
1007834214 6:44662392-44662414 CAAGGAAAAGAGAGAGGGGGTGG - Intergenic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1009311766 6:62162811-62162833 CAGGAGAAAGAGAGGAGTGAAGG + Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010338900 6:74724310-74724332 TAGGGCAAGGGGAGGAGGGAGGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011550031 6:88523200-88523222 CAGGGCAATTAGACGGGAGAAGG - Intergenic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1011656297 6:89555085-89555107 GAGGGGGGAGAGAGGGGGGAGGG - Intronic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012245251 6:96919025-96919047 CAGGGAGAAGAGAGGTGGGGAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012791929 6:103709260-103709282 CAAGTCAAAGAAAGGGGTGATGG + Intergenic
1013173709 6:107659887-107659909 CAGGGGAAGGGGAGGCGGGAGGG + Exonic
1013619008 6:111871742-111871764 CAGGGGAAAGAACGAGGGGATGG + Intronic
1013863841 6:114669814-114669836 CAGGACAAAGAGAGAGTGAAGGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1014558636 6:122863690-122863712 CAGGGCAAAGTGAGGAAGGGAGG + Intergenic
1014569826 6:122995974-122995996 AAGGGCGAAGAGAGGGGCGTGGG + Exonic
1014777119 6:125523995-125524017 AAGGGCAGAGAGATGAGGGAGGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017224971 6:152010465-152010487 GAGGGCAAAGAGAGAAGGGAAGG + Intronic
1017259661 6:152371656-152371678 GAAGGCAGAGAGAGAGGGGAGGG + Intronic
1017995891 6:159531407-159531429 CAAAGCAGAGAGAGGGGAGAGGG + Intergenic
1017996594 6:159536902-159536924 AAGGGCAAACAGAGAGGAGAAGG + Intergenic
1018006039 6:159622895-159622917 AAGGGCAAAGAGAGGGTGAGAGG + Intergenic
1018100166 6:160430921-160430943 CAGAGCCCAGAGTGGGGGGAGGG + Intronic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018612426 6:165659665-165659687 CAGGGCAAGGTGTGGGGCGAGGG + Intronic
1018664329 6:166120795-166120817 CAGGGCATAGATAGGAGGGGAGG + Intergenic
1018752876 6:166822436-166822458 CAAGCCAAAGAGAGGTGGGGTGG + Intronic
1020076797 7:5263665-5263687 CAGGCCAGAGAGAGGTGGGCTGG + Intergenic
1020129288 7:5550483-5550505 CAGGGCAGAGAGAAAGGGGTAGG - Intronic
1020201922 7:6086675-6086697 AAGGGGAAAGGGAAGGGGGAAGG - Intergenic
1020704459 7:11526696-11526718 CAGGAGAAAGAGAGGGGAAAGGG - Intronic
1021116003 7:16747387-16747409 AAGGGGAGAGAGAGGAGGGAAGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1022339401 7:29454187-29454209 TAGGGCAAAGAAAGGGGAGAAGG + Intronic
1022401099 7:30038501-30038523 AAGGGTAAAGGGAGAGGGGAAGG + Intronic
1022482366 7:30752436-30752458 CTGCCCAAAGAGAGGGGGCAGGG - Intronic
1022628227 7:32060296-32060318 AAGGGCACAGAGTGGGGAGAGGG - Intronic
1022648779 7:32256070-32256092 CAGGGCAAGGAGATCAGGGAAGG + Intronic
1022842198 7:34175338-34175360 CGAGTCAAAGAGAGGGGTGACGG - Intergenic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023410421 7:39884520-39884542 CAGGGCACAGGGAGTGGGGTGGG - Intergenic
1023717564 7:43059325-43059347 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1023842560 7:44105302-44105324 GAGGGCAAAGGCAGGAGGGAGGG - Intronic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024281830 7:47724917-47724939 CAGATCAAAGAAAGGGGGAAAGG - Intronic
1024472017 7:49774731-49774753 CGGGGCTTAGAGAGCGGGGAGGG + Intronic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1024919980 7:54545660-54545682 AAGGGGAAAGAGAGAGGGAAGGG + Intronic
1025078540 7:55963754-55963776 CAGGAGAAAGAAAGGAGGGAAGG - Intronic
1025202298 7:56969929-56969951 CAGGCCAGAGAGAGGTGGGCCGG - Intergenic
1025669649 7:63606998-63607020 CAGGCCAGAGAGAGGTGGGCCGG + Intergenic
1025673246 7:63627520-63627542 GAGGGTAAAGGGAGGAGGGAAGG + Intergenic
1025978440 7:66388116-66388138 CAGGGCAAGGTAAGTGGGGAGGG - Intronic
1026362723 7:69617531-69617553 GAGGGGACAGAGAGTGGGGAGGG + Intronic
1026524817 7:71144667-71144689 CAGGGCACAGAGTGAGGAGATGG + Intronic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1027232555 7:76281398-76281420 CAGGGCACGGAGGGGGGAGAGGG - Intronic
1027681893 7:81232596-81232618 CAGGGCAAGCAGGGGTGGGAGGG + Intergenic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1028239896 7:88406948-88406970 CAGGGCTGAGAGAGGGAGGGGGG - Intergenic
1028760594 7:94491775-94491797 CAGGGGAAAGAGTGGGAGGGAGG + Intergenic
1028920949 7:96309554-96309576 CATGGCAAAGTAAAGGGGGAAGG - Intronic
1028984697 7:97000544-97000566 CAGAGCAAAGGGAGAAGGGAGGG - Intergenic
1029211876 7:98916030-98916052 CAGGGCCAGGGGAGGGGGGCAGG - Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1031016703 7:116583219-116583241 CAGGGCAAAGAAAGAGGAGGAGG + Intergenic
1031036890 7:116797302-116797324 TAGAGCAAAGAAAGGGTGGATGG + Intronic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031698325 7:124889305-124889327 AAAGGCCAAGAGAGGTGGGAAGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032070807 7:128805526-128805548 TAGGGCACAGAGGGTGGGGAAGG + Intronic
1032268481 7:130384282-130384304 CGGGTGAAAGAGAGTGGGGAAGG - Intronic
1032504592 7:132425683-132425705 GAGGACAAAGAGAGAGGAGAAGG + Intronic
1032954655 7:136956792-136956814 CAGGGAACAGGGAGGGGGAATGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033587718 7:142786824-142786846 GAAGGCATAGAGAGGGGAGAGGG - Intergenic
1033686000 7:143641984-143642006 CAGGGCTAGGGGAGGGGGCAGGG + Intronic
1033689742 7:143725331-143725353 CAGGGCTAGGGGAGGGGGCAGGG - Intronic
1033698613 7:143815637-143815659 CAGGGCTAGGGGAGGGGGCAGGG - Intergenic
1033891621 7:146019340-146019362 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034448014 7:151123216-151123238 GAGGCCAAAAAGAGGGGGCAAGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1035764050 8:2091556-2091578 CACGACAGAGAGAGGGTGGAGGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036583421 8:10099975-10099997 CAGGACAAAGGCAGAGGGGATGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037588522 8:20294650-20294672 CAGTGCAAGGGGAGGAGGGAGGG - Intronic
1037804294 8:22050531-22050553 GAGGTCAAAGAGAGGGAGGGAGG - Intronic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1038019601 8:23541704-23541726 GAGGGCAGAGAAAGTGGGGAGGG - Intronic
1038158406 8:25013115-25013137 CAGGGCAATCAGAGAGGAGAAGG + Intergenic
1038415078 8:27389243-27389265 GAAGGCAGAGAGAGGAGGGAAGG + Intronic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1039031913 8:33318378-33318400 AAGGGAAAAGAGTGAGGGGAAGG + Intergenic
1039320755 8:36427861-36427883 AAGGGGAAAAAAAGGGGGGAAGG + Intergenic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039905857 8:41785958-41785980 CAGGGAGAAGAGACGCGGGAGGG - Intronic
1039982823 8:42422868-42422890 CAAGGAAAAGAGGGAGGGGAAGG - Intronic
1040661134 8:49577190-49577212 CAGGGCAAACAGAGGGGATTTGG + Intergenic
1040909181 8:52501209-52501231 AAGGACAAAGAGAGGGGGAATGG + Intergenic
1041012865 8:53560572-53560594 CAGAGCATTGAGAGGGGGCATGG + Intergenic
1041267668 8:56081044-56081066 CAGGACAAAGAGAGGAGACAGGG - Intergenic
1041296488 8:56362479-56362501 CAGTTCAAGGAGAGAGGGGATGG - Intergenic
1041546801 8:59054940-59054962 AAGGAAAAAGAGAGGAGGGAGGG + Intronic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041613219 8:59875574-59875596 CAAGTCAAAGAAAGGGGTGACGG - Intergenic
1041715752 8:60930624-60930646 GAGGGTAAAGGGTGGGGGGAGGG - Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1042087074 8:65120869-65120891 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1042094927 8:65204141-65204163 GAGGGGACAGAGAGGGGGAAAGG + Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1043241508 8:77940741-77940763 CAAGTCAAAGAAAGGGGTGATGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043766856 8:84146368-84146390 CTGGACAGAGGGAGGGGGGAAGG + Intergenic
1043772494 8:84223059-84223081 CAGGGCAAAGGGAGAGAGAAAGG - Intronic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1045408474 8:101891731-101891753 CAAGTCAAAGAAAGGGGTGATGG + Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045485527 8:102628167-102628189 CAGGGCAAAGGGAGGTGAAAGGG - Intergenic
1046458608 8:114504257-114504279 CGAGTCAAAGAAAGGGGGGACGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047494746 8:125401641-125401663 CCAGGCAAAGAGACGGGGAACGG - Intergenic
1047703958 8:127478864-127478886 CACGTCTAAGAGAGGGGAGAAGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048259345 8:132932378-132932400 CTGGGCAAATACAGGGGGAAGGG + Intronic
1048383125 8:133885869-133885891 GAGGGGAAAGAGAGAGGGTAGGG + Intergenic
1048477275 8:134754926-134754948 CAGAGCCAAGAGATGGGAGATGG + Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1049263541 8:141652838-141652860 CAGGGCAGAGGGAGGGGATATGG - Intergenic
1049601041 8:143507776-143507798 GAGGGCAGAGACAGGGGGAAGGG + Exonic
1049609973 8:143550352-143550374 CAGGGCAATGAGATGGGGTTAGG - Intergenic
1049777004 8:144411034-144411056 CAGGGCAACAAGTGGGGAGAAGG - Intronic
1050041342 9:1496951-1496973 AAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1050671631 9:8004364-8004386 CAGGGCAATGAGGCAGGGGAAGG - Intergenic
1051187710 9:14477959-14477981 CAGGGCATAGAATGGGGGGTGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1052744191 9:32423749-32423771 CAGGGCAAAGGGTGGGAGGGAGG + Intronic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053448844 9:38175956-38175978 TGGGGCAAAGAGAGGGAAGATGG - Intergenic
1054745771 9:68852616-68852638 CAGGGCACAGAGCAGGGTGAAGG + Intronic
1054834937 9:69667463-69667485 GAGGTCAAAGAGAGGTGGGCAGG - Intronic
1054886521 9:70204829-70204851 CAAGTCAAAGAAAGGGGTGAAGG - Intronic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056752646 9:89363393-89363415 CCGGGCAAAGAAAGGAGGGCTGG - Intronic
1056949664 9:91032027-91032049 CAGGGCAAATAGAGAAGGAAAGG - Intergenic
1057138707 9:92713838-92713860 CAGGGCAGAGAGCTGTGGGAGGG + Exonic
1057450545 9:95155229-95155251 GAGAGAAAAGAGAGAGGGGAGGG + Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059250898 9:112887167-112887189 CAGGGCACAGAGAGTGGAGACGG - Intronic
1059916873 9:119113686-119113708 GAGGGTAGAGAGTGGGGGGAGGG + Intergenic
1060110778 9:120904912-120904934 CAGGGCACAAAGATGGGTGAAGG - Exonic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060470719 9:123945885-123945907 CAGGGAAAAGGGCGAGGGGAAGG + Intergenic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060798233 9:126526874-126526896 CAGGGCATAGAGAGTGAGGTAGG + Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061073469 9:128326376-128326398 GAGGACAAGGAGAGGGGGAAAGG + Intronic
1061156194 9:128863220-128863242 CAGTGCTGAGAGACGGGGGAAGG + Intronic
1061390603 9:130315311-130315333 GAGGGCAGAGGGAGGAGGGAGGG - Intronic
1061935139 9:133853318-133853340 CTCGGCCAAGAGAGGGTGGAAGG + Intronic
1062014196 9:134283081-134283103 GAGGGCAAGGCGGGGGGGGAGGG - Intergenic
1062269513 9:135702184-135702206 CAGGGCAACGCGAGGGAAGAAGG + Exonic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062581637 9:137231537-137231559 CAGGGCGTAGAGAGGGAGGGTGG + Intronic
1203740875 Un_GL000216v2:175862-175884 AAGGGCACAGAGAGGCGAGAGGG - Intergenic
1185661974 X:1735354-1735376 GAGGGAAAAGAGTGGGGGAAAGG - Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1186176730 X:6932712-6932734 CAGGTCAAAGAAAGGGGTGACGG + Intergenic
1186239979 X:7555369-7555391 AAGGGAGAAGAGAGGAGGGAAGG + Intergenic
1186243361 X:7593502-7593524 CAGGTCAAAGAAAGGGGTGACGG - Intergenic
1187425650 X:19175327-19175349 ACGGGCAAGGAGAGGGGAGAGGG - Intergenic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1189480620 X:41389702-41389724 CAGGACAGAGAGAGGAGGGCGGG + Intergenic
1189843109 X:45103341-45103363 CAGGAAAAAGAGTTGGGGGAAGG - Intronic
1190339513 X:49285946-49285968 CAGGCCACAGAGAGGGGAGGAGG - Exonic
1190711816 X:53077085-53077107 CACGTCAAAGACAGGTGGGAAGG - Exonic
1191041631 X:56087431-56087453 CAGGAACAAGAGAGGGGTGAGGG - Intergenic
1191145753 X:57163635-57163657 CAAGTCAAAGAAAGGGGTGATGG - Intergenic
1191223772 X:58017899-58017921 CAGAGCATAGAGAGGGAGCATGG + Intergenic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1192445110 X:71205322-71205344 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1192717955 X:73663760-73663782 CAGGGAAAAGAAAGGGGAAAGGG - Intronic
1193038824 X:76982747-76982769 CAGGGCAATGAGGCGGGAGAAGG + Intergenic
1193152605 X:78140317-78140339 CAGGGCCAAGAGAGGCTAGAGGG - Intergenic
1193783650 X:85733840-85733862 CTGGTCAAAGAAAGGGGTGATGG + Intergenic
1193956012 X:87863639-87863661 CAAGGCAAAGAAAGGGGACAAGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194365053 X:93004590-93004612 CAAGGCCAAGAGAGAGAGGAGGG - Intergenic
1194736203 X:97515284-97515306 CTGGTCAAAGAAAGGGGTGACGG - Intronic
1194814551 X:98426322-98426344 CAGGGCAATTAGGGAGGGGAAGG - Intergenic
1194991333 X:100550494-100550516 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1195552881 X:106188017-106188039 GAGTGGAAAGAGAGGAGGGAAGG - Intronic
1195662261 X:107391303-107391325 AGGGGCAGAGAGAGGGGGTAAGG - Intergenic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196120473 X:112045114-112045136 CATGGCAAAGAGATGGGGTGTGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196216810 X:113062392-113062414 GAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196820048 X:119694295-119694317 CAGTCCCAAGAGAGAGGGGAGGG - Intergenic
1197263512 X:124341667-124341689 AAGGGAAAAAAGAGGGGGAAAGG + Intronic
1197496878 X:127195359-127195381 CACGGCATAGAGTTGGGGGAAGG + Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197784375 X:130185996-130186018 CAGGGCAAAATCAGGGGGGCAGG + Intergenic
1197817936 X:130517607-130517629 CAAGTCAAAGAAAGGGGTGACGG + Intergenic
1198074319 X:133180206-133180228 CAAGGCATAGAGAGGGGAGGGGG - Intergenic
1199205585 X:145145198-145145220 GGGGGCAACGAGAGGGGGTAGGG - Intergenic
1199408903 X:147496383-147496405 CATGGAAAGGAGTGGGGGGAGGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199618806 X:149680931-149680953 CAGGGAAAAGAAAGGGGAAAGGG - Intergenic
1199623836 X:149722318-149722340 CAGGGAAAAGAAAGGGGAAAGGG + Intergenic
1199669794 X:150134508-150134530 CAGGGCAATGAGGCGGGAGAAGG + Intergenic
1199900633 X:152168572-152168594 CAGGAAAAAGAGGGGGGGAAAGG + Intronic
1199953642 X:152725355-152725377 AAGGGGGAAGAGAGGAGGGAGGG + Intergenic
1199956038 X:152743095-152743117 AAGGGGGAAGAGAGGAGGGAGGG - Intergenic
1199991970 X:152992590-152992612 CCTGGCAAAGAGTGGGGAGAGGG - Intronic
1200089732 X:153628818-153628840 CAGGGCCAAGAGCCGGGGGAGGG + Intergenic
1200673281 Y:6120850-6120872 CAAGGCCAAGAGAGAGAGGAGGG - Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201286028 Y:12379439-12379461 CAGGACCAAGAGAGGAGGGGAGG + Intergenic
1201509798 Y:14746431-14746453 CAGTGCAAAGACAGTGGCGAAGG - Intronic
1201512892 Y:14784983-14785005 CAGGGCAGAGGGTGGGGAGAGGG + Intronic
1201925051 Y:19275095-19275117 CAGGGGAAAGACATGGGGGGAGG - Intergenic