ID: 1066701811

View in Genome Browser
Species Human (GRCh38)
Location 10:38137574-38137596
Sequence GACCTGGCCTTCCAAACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066701811_1066701818 26 Left 1066701811 10:38137574-38137596 CCTGGTGTTTGGAAGGCCAGGTC 0: 1
1: 0
2: 2
3: 24
4: 412
Right 1066701818 10:38137623-38137645 GACCTTTCACCCTTGAATGTGGG 0: 1
1: 0
2: 0
3: 7
4: 109
1066701811_1066701817 25 Left 1066701811 10:38137574-38137596 CCTGGTGTTTGGAAGGCCAGGTC 0: 1
1: 0
2: 2
3: 24
4: 412
Right 1066701817 10:38137622-38137644 AGACCTTTCACCCTTGAATGTGG 0: 1
1: 0
2: 1
3: 5
4: 113
1066701811_1066701813 -6 Left 1066701811 10:38137574-38137596 CCTGGTGTTTGGAAGGCCAGGTC 0: 1
1: 0
2: 2
3: 24
4: 412
Right 1066701813 10:38137591-38137613 CAGGTCTTTATTGTCTACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066701811 Original CRISPR GACCTGGCCTTCCAAACACC AGG (reversed) Intergenic
901029365 1:6298068-6298090 CGCCTGTCCTTTCAAACACCTGG + Intronic
901599347 1:10410534-10410556 GCCCAGGTCATCCAAACACCTGG + Intronic
902080084 1:13814777-13814799 GAGCTGGCTCTGCAAACACCTGG + Intronic
902516809 1:16993892-16993914 GAGCTGGGCCTCCAAACCCCAGG + Intronic
902561723 1:17281767-17281789 GAGCTTGCCTTTGAAACACCTGG + Intronic
903124267 1:21237030-21237052 GGACTGGCCTTCCACACACAGGG + Intronic
903764352 1:25724273-25724295 CACCTGGCCTCCCAAAGTCCTGG + Intronic
905078645 1:35297097-35297119 GCCCTGGCCTTCCAAAGTGCTGG + Intronic
905588078 1:39137613-39137635 GCCCTGGCCTCCCAAAGAGCTGG + Intronic
905723427 1:40227753-40227775 GCCCTGGCCTCCCAAACTGCTGG - Intronic
906286778 1:44592781-44592803 GACCTGGTCTTGAAAGCACCTGG - Intronic
906748445 1:48237893-48237915 GACCTGGTCTGTCAATCACCTGG + Intronic
906975914 1:50572946-50572968 GACCTGGCCTCCCAAAATGCTGG + Intronic
907398186 1:54207000-54207022 GCCTTGGCCTTCCAAACTGCGGG + Intronic
908299670 1:62751903-62751925 GCCTTGGCCTCCCAAACAGCTGG + Intergenic
910639473 1:89444082-89444104 GCCTTGGCCTTCCAAAGTCCTGG + Intergenic
910913203 1:92259982-92260004 GCCTTGGCCTTCCAAAGAGCTGG + Intronic
911124830 1:94331733-94331755 GACCTGGCCTCCCAAAGTGCTGG - Intergenic
912183092 1:107242021-107242043 GACTTGGCCTTCCAAAGTGCTGG - Intronic
914404173 1:147354400-147354422 GCCTTGGCCTTCCAAACAGCTGG - Intergenic
915666372 1:157448917-157448939 GACCTGGCCTGCCACACACCTGG + Intergenic
916950067 1:169770895-169770917 GCCTTGGCCTTCCAAAGTCCTGG - Intronic
917303938 1:173608215-173608237 GACTTGGCCTCCCAAAGTCCTGG - Intergenic
917352285 1:174090721-174090743 CACCTGGCCTTCTACACACCAGG + Intergenic
917921538 1:179754885-179754907 GCCTTGGCCTTCCAAAGAACTGG - Intronic
918026413 1:180753313-180753335 GCCCTGGCCTCCCAAACTGCTGG - Intronic
919345502 1:196371132-196371154 GACTTGGCCTTCCAAAGTGCTGG - Intronic
919655902 1:200196936-200196958 AACCTGCTCTTCCAAACACATGG + Intergenic
919898261 1:202023335-202023357 CAGCTGGCCTTACAAACACATGG - Intergenic
920739522 1:208567372-208567394 GCCTTGGCCTTCCAAAGTCCTGG + Intergenic
921710785 1:218371048-218371070 CACCGGGCCTTCCAAAGAGCTGG - Intronic
923109424 1:230879484-230879506 TGCCTGGCCTTCCCAACTCCAGG + Intergenic
923165618 1:231358783-231358805 GCCTCGGCCTTCCAAAGACCTGG - Intergenic
923606757 1:235451099-235451121 GGCTTGGCCTTCCAAACCCAAGG - Intronic
923797874 1:237176111-237176133 GCCTTGGCCTCCCAAACAACTGG - Intronic
924751854 1:246901088-246901110 CACCTGGCCTTCCAAAGTGCTGG - Intronic
1063405601 10:5791496-5791518 GCCTTGGCCTCCCAAAGACCTGG - Intronic
1064309491 10:14199637-14199659 GCCTTGGCCTCCCAAACAGCTGG + Intronic
1064473121 10:15657600-15657622 GCCTTGGCCTTCCAAACTCCTGG + Intronic
1064482459 10:15753155-15753177 GACTTGGCCTCCCAAAGTCCTGG - Intergenic
1064485492 10:15784493-15784515 GTCCTGGCCTTCCAAAGTGCTGG - Intronic
1064571920 10:16702471-16702493 GAGATGGCCTTCCAAAGCCCTGG - Intronic
1065025688 10:21537035-21537057 GCCTTGGCCTTCCAAACTGCTGG + Intronic
1065433225 10:25680950-25680972 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1065840845 10:29699764-29699786 GAACTGGCCTTCCACACTCTTGG - Intronic
1066391501 10:34980589-34980611 GCCTTGGCCTCCCAAACAGCTGG - Intergenic
1066701811 10:38137574-38137596 GACCTGGCCTTCCAAACACCAGG - Intergenic
1067500442 10:46799232-46799254 GACTTGGCCTCCCAAAATCCTGG + Intergenic
1067594186 10:47541074-47541096 GACTTGGCCTCCCAAAATCCTGG - Intronic
1067641295 10:48049189-48049211 GACTTGGCCTCCCAAAATCCTGG - Intergenic
1068111697 10:52687959-52687981 GCCTCGGCCTTCCAAACTCCTGG - Intergenic
1068755762 10:60650832-60650854 GCCCTGGCCTTCCAAAGTACTGG - Intronic
1068982099 10:63072699-63072721 GCCTTGGCCTTCCAAAGTCCTGG + Intergenic
1069411623 10:68160156-68160178 GGCCTGGCCTCCCAAAGTCCTGG - Intronic
1069542926 10:69309058-69309080 GACTTGGCCTTCCAAAGTGCTGG - Intronic
1069904153 10:71722630-71722652 GTCCTGGCCTTCCCTACCCCTGG - Intronic
1069927313 10:71859763-71859785 GACTTGGCCTTCCAAAGCGCTGG - Intergenic
1070142096 10:73745797-73745819 GACTTGGCCTTCCAAAGTGCTGG + Intronic
1070757061 10:78999834-78999856 TACCTGTCCTGCCAAACACGGGG - Intergenic
1070801958 10:79249055-79249077 GTCCTGGCCTCCCACACACAGGG - Intronic
1071699431 10:87914593-87914615 GACCTTGCCCTCCAAATATCAGG - Intronic
1071845514 10:89517558-89517580 GCCTTGGCCTCCCAAACCCCTGG + Intronic
1072069551 10:91903370-91903392 GCCCTGGCCTTCCAAAGTGCTGG + Intergenic
1073099782 10:101000405-101000427 GGCCTGGCTTTCCAGACTCCTGG + Exonic
1074559099 10:114519368-114519390 GACCTGGCCTTGCACCAACCAGG - Intronic
1075491926 10:122879101-122879123 GACCGCTCCATCCAAACACCTGG + Intronic
1075734226 10:124654297-124654319 GGCCTGGCCCTCCCAACCCCTGG + Intronic
1077797191 11:5505152-5505174 CACCTGGCCTTCCAATTAACAGG + Intronic
1078229350 11:9425489-9425511 GCCCTGGCCTCCCAAATAGCTGG - Intronic
1078992818 11:16666554-16666576 GCCTTGGCCTTCCAAAGAGCTGG - Intronic
1079434224 11:20429557-20429579 AACCTTGGCTTCCAAACAACTGG - Intronic
1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG + Intronic
1082727058 11:56748655-56748677 GAGCTGGCCTTCCAAACCAAGGG - Intergenic
1083986965 11:66221864-66221886 GCCCTGGCCTCCCAAAGAGCTGG - Intronic
1084880451 11:72167701-72167723 GACTTGGCCTTCCAAAGTGCTGG + Intergenic
1084884945 11:72197716-72197738 GACTTGGCCTCCCAAAGAGCTGG - Intergenic
1085142265 11:74156718-74156740 GCCTTGGCCTTCCAAAATCCTGG - Intronic
1085582982 11:77671881-77671903 GCCCTGGCCTCCCAAACTGCCGG + Intronic
1086499283 11:87435733-87435755 GCCCTGGCCTCCCAAACTGCTGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1090439878 11:126716620-126716642 AACCTGGGCCTCCAAACACCAGG + Intronic
1090503200 11:127282204-127282226 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
1091425255 12:382314-382336 GCCTTGGCCTCCCAAATACCTGG - Intronic
1091801249 12:3326148-3326170 GACCTGGCTGTACAATCACCTGG + Intergenic
1092357599 12:7809657-7809679 GCCCTGGCCTTCCAAAGAGCTGG + Intergenic
1092788819 12:12054251-12054273 GCCTTGGCCTTCCAAAGAGCTGG - Intronic
1093454978 12:19356263-19356285 GACCTGGCCTCCCAAAGTGCTGG - Intronic
1096250001 12:50025014-50025036 GCCCGGGCCTCTCAAACACCAGG + Intronic
1096572681 12:52532898-52532920 GACCAGGCCGTCAAAACAACAGG + Intergenic
1098885344 12:75955155-75955177 GCCCTGGCCTTCCAAAGCACTGG + Intergenic
1099828863 12:87814361-87814383 GACTTGGCCTTCCAAAGTTCTGG - Intergenic
1100510280 12:95264549-95264571 GCCCTAGCCTCCCAAATACCTGG + Intronic
1100547981 12:95621533-95621555 GCCCTGGCCTTCCAAAGTCCTGG + Intergenic
1100837614 12:98581560-98581582 GCCCTGGCCTCCCAAACCACTGG - Intergenic
1101424221 12:104574940-104574962 GCCTTGGCCTCCCAAAGACCTGG - Intronic
1101538124 12:105639336-105639358 GCCCTGGCCTCCCAAACTGCTGG + Intergenic
1101677197 12:106927896-106927918 GTTCTGGGCTTCCAAACACAGGG - Intergenic
1101917148 12:108904522-108904544 ACCTTGGCCTTCCAAACTCCTGG + Intergenic
1101944354 12:109124961-109124983 GCCTTGGCCTTCCAAAGAGCTGG + Intronic
1101957925 12:109227198-109227220 GCCCTGGCCTTCCAAAATGCTGG + Intronic
1102170642 12:110839847-110839869 GCCTTGGCCTCCCAAACTCCTGG - Intergenic
1102545056 12:113648486-113648508 GCCTTGGCCTTCCAAAGAGCTGG - Intergenic
1102590407 12:113952192-113952214 GACTTGGCCTAGCAAACCCCAGG + Intronic
1102770799 12:115474304-115474326 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1103346360 12:120253221-120253243 GCCTTGGCCTTCCAAAGAGCTGG - Intronic
1103625036 12:122212083-122212105 GACTTGGCCTTCCAAAGTGCTGG + Intronic
1103756686 12:123213106-123213128 GACCTGGCCTCCCAAAGTGCTGG + Intronic
1104360738 12:128130382-128130404 GACCTGCCCTTACAAATGCCTGG + Intergenic
1104732632 12:131116470-131116492 TGCCTGCCCTTCCAAACATCAGG - Intronic
1106573681 13:30954705-30954727 ACCCTGGCCTTCCAAAGCCCTGG + Intronic
1107115758 13:36743558-36743580 GCCTTGGCCTTCCAAATTCCTGG + Intergenic
1107132071 13:36907417-36907439 CACCTGGCCTCCCAAAGCCCTGG - Intronic
1107946812 13:45426332-45426354 GCCCTGGCCTTCCAAAGTGCTGG + Intergenic
1108214978 13:48175118-48175140 GCCTTGGCCTCCCAAACTCCTGG + Intergenic
1111364257 13:87221132-87221154 GCCCTGGCCTACCAAAGTCCTGG - Intergenic
1112017922 13:95346818-95346840 GCCTTGGCCTTCCAAAGAACTGG + Intergenic
1112723175 13:102269873-102269895 AACCAGGCCTTCCAAACAGATGG - Intronic
1113873397 13:113578846-113578868 GCCTTGGCCTTCCAAAGTCCTGG + Intergenic
1115689848 14:35831187-35831209 GACTTGGCCTTCCAAACTGCTGG + Intronic
1116000505 14:39237987-39238009 GCCTTGGCCTTCCAAAGAGCTGG + Intronic
1116343209 14:43753267-43753289 GCCCTGGCCTTCCAAAGGGCTGG + Intergenic
1116847546 14:49879252-49879274 GACTTGGCCTCCCAAACTGCTGG + Intergenic
1117128584 14:52660081-52660103 GCCCTGGCCTTCCAAAGTACTGG + Intronic
1119997333 14:79267731-79267753 GACTTGGCCTCCCAAACTGCTGG + Intronic
1120009605 14:79398758-79398780 GACTTGGCCTTCCAAAGTGCTGG - Intronic
1120867895 14:89311238-89311260 GACCTGGCCTCCCAAAGTGCTGG - Intronic
1121301847 14:92878090-92878112 CATCTGTCCTTCCAAACTCCAGG + Intergenic
1122279364 14:100612081-100612103 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
1123137315 14:106040150-106040172 GACCTGGCCTCCCAAAGTACTGG - Intergenic
1202924114 14_KI270724v1_random:8405-8427 GCCCTGGCCTTCCTGACATCAGG + Intergenic
1123655562 15:22514377-22514399 GACTTGGCCTCCCAAAGAGCTGG - Intergenic
1125163320 15:36673213-36673235 GAATGGGCCTTTCAAACACCCGG - Intronic
1127170200 15:56293083-56293105 GCCTTGGCCTTCCAAACTGCTGG - Intronic
1127991366 15:64120560-64120582 GCCTTGGCCTTCCAAACTGCTGG - Intronic
1128057508 15:64711340-64711362 GCCTTGGCCTCCCAAACTCCTGG - Intergenic
1128123451 15:65172210-65172232 GCCTTGGCCTTCCAAACGGCTGG + Intronic
1128152118 15:65369687-65369709 GAACTTGCATTCCACACACCAGG + Intronic
1128372669 15:67051912-67051934 GACCAGGCCCTCCAGACCCCTGG + Intergenic
1128780181 15:70354044-70354066 GAACTGGCTTTCCAAGCTCCAGG - Intergenic
1129313453 15:74727414-74727436 GACTCGGCCTTCCAAAGTCCTGG - Intergenic
1129503882 15:76064781-76064803 TGCCTGGACTTCCAAAAACCTGG - Intronic
1130170347 15:81505943-81505965 GACTTGGCCTTCCAAAGTGCTGG + Intergenic
1130210573 15:81918263-81918285 GCCTTGGCCTCCCAAACTCCTGG - Intergenic
1131205752 15:90444873-90444895 GCCCTGGCCTTCCAAAATGCTGG - Intronic
1131872692 15:96778146-96778168 GACCTGGCTTTCTAATCACAAGG + Intergenic
1133142828 16:3760651-3760673 GCCCTGGCCTTCCAAAGTGCTGG + Intronic
1133543062 16:6775074-6775096 GACCTGGCCTCCCAAAGTGCTGG - Intronic
1133676488 16:8078154-8078176 GACTTGGCCTCCCAAACTGCTGG - Intergenic
1133821614 16:9242044-9242066 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1133998999 16:10768094-10768116 CACCTGTCCTTCCACACCCCTGG - Exonic
1134191225 16:12122526-12122548 GGCCAGGCCTTCCAGACACTGGG + Intronic
1134366621 16:13584988-13585010 GCCTTGGCCTTCCAAACTGCTGG - Intergenic
1135140740 16:19919356-19919378 GCCCTGGCCTTCCAAAGCACTGG - Intergenic
1136177512 16:28527881-28527903 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
1137967899 16:52955045-52955067 ACCTTGGCCTTCCAAACAGCTGG - Intergenic
1138012298 16:53393966-53393988 GACCCGGCCTTTCAAAAACCTGG + Intergenic
1138512035 16:57514447-57514469 GCCCTGGCCTTCCAAACTGTTGG + Intronic
1138909073 16:61374705-61374727 GCCCTGGCCTCCCAAACTGCTGG - Intergenic
1139456224 16:67079895-67079917 GACTTGGCCTCCCAAAATCCTGG - Intronic
1140396065 16:74627798-74627820 GCCCTGTCCTGCCAAACACTAGG - Intronic
1141168001 16:81673264-81673286 GCCTTGGCCTTCCAAACTGCTGG - Intronic
1141335058 16:83146836-83146858 GCCTTGGCCTTCCAAACTGCTGG - Intronic
1141453622 16:84122599-84122621 GCCCTGGCCTTCCAAACTGCTGG + Exonic
1142520477 17:501059-501081 GACTTGGTCTTCCAAAGTCCTGG + Intergenic
1143015896 17:3891038-3891060 GACCTGGCCTTCCAGGAACTCGG + Intronic
1144425118 17:15134217-15134239 GCCCTGCCTTTTCAAACACCAGG + Intergenic
1144850556 17:18241996-18242018 GAGCTGCCCCTCCACACACCTGG - Exonic
1146157104 17:30533920-30533942 GCCCTGGCCTCCCAAAGAACTGG + Intergenic
1146353202 17:32113002-32113024 GCCCCGGCCTTCCAAACTGCTGG + Intergenic
1146722749 17:35134647-35134669 GCCTTGGCCTCCCAAACTCCTGG + Intronic
1147138216 17:38447036-38447058 CTCCTGGCCTCCCAAACACTGGG + Intronic
1147629510 17:41920655-41920677 GACTTGGCCTTCCAAAATTCTGG - Intronic
1147791580 17:43017123-43017145 GCCCTGGCCTTCCAAAGTGCTGG + Intronic
1148956673 17:51359964-51359986 CACTTGGCCTTCCAAATACGGGG - Intergenic
1149551138 17:57540759-57540781 GGCATGGCCTTGCCAACACCTGG + Intronic
1150072911 17:62167804-62167826 GCCTTGGCCTCCCAAACAGCTGG - Intergenic
1150547006 17:66169531-66169553 GCCCTGGCCTCCCAAAGAGCTGG + Intronic
1151908334 17:77064378-77064400 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1153038807 18:790998-791020 GCCCTGGCCTTCCAAAATGCTGG - Intronic
1153662849 18:7340874-7340896 GCCTTGGCCTTCCAAAGAGCTGG + Intergenic
1155213318 18:23620891-23620913 GGCCTTGCCTTCCCGACACCAGG - Intronic
1157259280 18:46164704-46164726 GACTTGGCCTCCCAAAGAGCTGG - Intergenic
1157293390 18:46425391-46425413 TACCTGGCCTGCCACCCACCCGG - Intronic
1157441641 18:47716195-47716217 GAACTGGCCTTTCAAAGATCTGG - Intergenic
1157627635 18:49063876-49063898 GACTTGGCCTTCCAAAGTGCTGG + Intronic
1157922119 18:51723927-51723949 AACCTGGGTTTCCAAACTCCTGG + Intergenic
1158533107 18:58281225-58281247 GCCCTGGCCTCCCAAACTGCTGG + Intronic
1158883929 18:61807375-61807397 GCCTTGGCCTTCCAAAAAGCTGG + Intergenic
1161651126 19:5485777-5485799 GCCTTGGCCTTCCAAGTACCTGG - Intergenic
1161846835 19:6716483-6716505 GCCTTGGCCTCCCAAACAGCTGG + Intronic
1161924440 19:7290521-7290543 GCCTCGGCCTTCCAAAGACCTGG - Intronic
1162415700 19:10535669-10535691 GCCCTGGCCTTCCAAAGTCCTGG + Intergenic
1162722696 19:12671943-12671965 GCCCTGGCCTCCCAAAGAGCTGG + Intronic
1163738841 19:18998399-18998421 GCCTTGGCCTTCCAAAGTCCCGG + Intronic
1164008045 19:21169925-21169947 GTCCTGCCCTTCCAGAGACCTGG - Intronic
1164508363 19:28877735-28877757 GACCTGGTCTTACAAATGCCTGG + Intergenic
1165197695 19:34117868-34117890 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
1165214092 19:34257128-34257150 AACATGGTCTTCCAAACATCTGG - Intronic
1165501569 19:36193688-36193710 GCCTTGGCCTTCCAAAGTCCTGG + Intronic
1166044278 19:40220536-40220558 GCCCCGGCCTTCCAAAGTCCTGG - Intergenic
1167168626 19:47816504-47816526 GCCTTGGCCTCCCAAACCCCTGG + Intronic
1167225471 19:48236461-48236483 GCCCTGGCCTCCCAAAGTCCTGG + Intronic
1167430590 19:49452032-49452054 GCCCTGGCCTTCCAAAGTGCTGG - Intronic
926015707 2:9449490-9449512 GACTTGGCCTCCCAAAGTCCTGG - Intronic
926244118 2:11109828-11109850 GTCCTGGCCTTCCAAAGTGCAGG - Intergenic
926685632 2:15695632-15695654 GACCTGGTCTTCCAACCTCTGGG + Intronic
927095982 2:19747901-19747923 GACCTGGCCTGTTAAACCCCTGG - Intergenic
927294687 2:21440570-21440592 CACCTGACCTTCCCAACAGCTGG + Intergenic
927537690 2:23877159-23877181 GACTTGGCCTTCCAAAGTCCCGG - Intronic
927683831 2:25157449-25157471 GTCCTGCCCTTCCAAGCCCCTGG + Exonic
928124993 2:28609167-28609189 GCCTTGGCCTTCCAAAGAGCTGG + Intronic
928371917 2:30746144-30746166 GCCTTGGCCTTCCAAAATCCTGG + Intronic
929168412 2:38906717-38906739 GCCCTGGCCTCCCAAAATCCTGG - Intronic
929276840 2:40034964-40034986 GACCTGTCCTTCCAAAAGTCTGG + Intergenic
930012024 2:46944606-46944628 GTCTTGGCCTCCCAAACAGCTGG - Intronic
930132270 2:47864336-47864358 GCCCTGGCCTCCCAAACTGCTGG - Intronic
930288711 2:49467089-49467111 GCCTTGGCCTTCCAAAGTCCTGG + Intergenic
930385089 2:50684245-50684267 GACTTGGCCTCCCAAACTTCTGG - Intronic
931227970 2:60350451-60350473 GTTCTGGCCTTCCAGAAACCTGG + Intergenic
933821668 2:86118022-86118044 GACTTGGCCTCCCAAAGTCCTGG + Intronic
933894543 2:86798769-86798791 CACCTGGCCTTCCAAAGTGCTGG + Intronic
934889639 2:98055997-98056019 GGCATGGCCATCCAATCACCTGG - Intergenic
935983973 2:108654538-108654560 GACCTGGGCTTCCACAACCCTGG - Intronic
936136408 2:109898191-109898213 GACCTGGGCTTCCACAACCCTGG - Intergenic
936208289 2:110473294-110473316 GACCTGGGCTTCCACAACCCTGG + Intergenic
936486447 2:112929828-112929850 AACCTGGCTTTAGAAACACCTGG - Intergenic
936863267 2:117047489-117047511 GACTTGGCCTTCCAAATCCTGGG - Intergenic
938019127 2:127891847-127891869 GACCTGTCCTCCCAAGCTCCCGG - Intergenic
938124919 2:128664592-128664614 GCCCTGCCCTTCTAAACAGCAGG - Intergenic
941316501 2:163999609-163999631 GCCCTGGCCTCCCAAAATCCTGG - Intergenic
941748897 2:169115109-169115131 GACCTGGCCCTCCATGAACCAGG + Intergenic
941824930 2:169884395-169884417 GCCCTGGCCTCCCAAACTGCTGG + Intronic
942562524 2:177235578-177235600 GCCTTGGCCTCCCAAACTCCTGG - Intronic
943925857 2:193778863-193778885 GCCTTGGCCTCCCAAACACCTGG + Intergenic
944944145 2:204663587-204663609 GACCTGGGCTTACAAACTCCAGG + Intronic
945334219 2:208572498-208572520 GACTTGGCCTCCCAAACTGCTGG - Intronic
945461883 2:210118595-210118617 GCCCTGGCCTTCCAAAGTGCTGG - Intronic
945792197 2:214318790-214318812 CACCTTGTCTTCCAAACACACGG + Intronic
945856922 2:215080246-215080268 GCCTTGGCCTTCCAAAGTCCTGG - Intronic
945924620 2:215790542-215790564 AACTTGGACTTCCAAACACCAGG - Intergenic
946702255 2:222424970-222424992 GGCCTGGCCTTCCAGTAACCAGG + Intronic
946752176 2:222903389-222903411 GTCCTGGCCTCCCAAAGTCCTGG + Intronic
946800802 2:223414178-223414200 GCCTTGGCCTTCCAAAGAGCTGG + Intergenic
947862467 2:233370464-233370486 GCCCTGGCCTCCCAAAGTCCTGG + Intronic
948134976 2:235629617-235629639 GCCCTGGCCTTCCAAAGTGCTGG - Intronic
948661949 2:239512841-239512863 GACTTGGCCTTCCAAAGTGCTGG + Intergenic
948950221 2:241245549-241245571 GCCTTGGCCTTCCAAACTGCTGG - Intronic
1168903815 20:1388648-1388670 GAGCTGGCACTCCACACACCTGG + Intronic
1168929847 20:1612242-1612264 GCCTTGGCCTTCCAAACTGCTGG + Intronic
1168939882 20:1700259-1700281 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
1169263395 20:4153516-4153538 GACCTGGCCTCCCAGGGACCTGG + Intronic
1170585257 20:17729485-17729507 GACCTGGCCTCCCAAAGTGCTGG - Intronic
1170988252 20:21278198-21278220 GACTTGGCCTTCCAAAGTGCTGG - Intergenic
1170989760 20:21291325-21291347 GACTTGGCCTTCCACTGACCTGG - Intergenic
1171946044 20:31378333-31378355 CACCTGGACTTCCACCCACCTGG + Intronic
1172527481 20:35608698-35608720 GCCTTGGCCTTCCAAAGTCCTGG + Intergenic
1174010765 20:47447729-47447751 GCCTTGGCCTTCCAAAGTCCTGG - Intergenic
1174434620 20:50497309-50497331 GATCTTGACTTCCAAACAACTGG + Intergenic
1175000850 20:55629323-55629345 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1176121778 20:63457359-63457381 GACCGAGCCTCCCAAACACTGGG + Intronic
1176138575 20:63535735-63535757 CACCTGCCCCTCCAACCACCTGG + Intronic
1178953286 21:37003035-37003057 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1179519828 21:41935137-41935159 GCCCTGGCCTTCCAAAGTGCTGG + Intronic
1180001323 21:44996776-44996798 GACCAGGCCGTGCAAACACCAGG - Intergenic
1180557135 22:16587153-16587175 GCCTTGGCCTTCCAAACTACTGG + Intergenic
1180924808 22:19546014-19546036 GAACAGGTCTTCCACACACCTGG + Intergenic
1181930957 22:26401368-26401390 GACCTGACCTTCAATACTCCAGG + Intergenic
1182151460 22:28029916-28029938 GAGCTGACTTTCCAAACATCAGG - Intronic
1182626690 22:31652502-31652524 TTCCTTGCCTTACAAACACCTGG + Intronic
1182812119 22:33125692-33125714 GACTTGGCCTCCCAAAGTCCTGG + Intergenic
1183028873 22:35086991-35087013 GACCTAGGCTTCCCAACTCCCGG - Exonic
1183964248 22:41431850-41431872 GCCCTGGCCTGCCAGACACAGGG - Intergenic
1185062606 22:48614914-48614936 GGCCTGGCCTCCCAGTCACCGGG + Intronic
949367697 3:3301030-3301052 GACTTGGCCTTCCAAAGCACTGG + Intergenic
949713581 3:6900851-6900873 GACCTAGCCCTGCAAGCACCAGG + Intronic
950348290 3:12320580-12320602 CACCTGGCCTCCCAAACTCCTGG - Intronic
950427391 3:12931792-12931814 GACCTGGCCTCCCCTACACTCGG - Intronic
950555540 3:13693643-13693665 GCCCTGGCCTGCCAACCTCCAGG + Intergenic
950653225 3:14420731-14420753 GACTTGGCCTTCCAAAGTTCTGG + Intronic
951195759 3:19821774-19821796 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
951210274 3:19967038-19967060 GCCTTGGCCTTCCAAAGTCCTGG + Intronic
952261968 3:31748671-31748693 GACATGACCTTCTTAACACCAGG + Intronic
953395572 3:42566752-42566774 GCCTTGGCCTTCCAAAGCCCTGG - Intronic
953447259 3:42979160-42979182 GACCTTTCCTTCCTAGCACCTGG + Intronic
954299150 3:49689950-49689972 GAGCAGACCTTCCAGACACCCGG - Intronic
955215596 3:56982786-56982808 GACCTGGCCTGCAGAACCCCTGG + Intronic
955735986 3:62038643-62038665 GACTTGGCCTTCCAAAGTGCTGG + Intronic
956739429 3:72263795-72263817 GAGCTTGCCTGCCAAACATCTGG + Intergenic
956801052 3:72758814-72758836 GCCTTGGCCTTCCAAAGAGCTGG + Intronic
957772906 3:84717294-84717316 GACTTGGCCTTCCAAAGTGCTGG - Intergenic
958195716 3:90239802-90239824 GCCTTGGCCTTCCAAAGTCCTGG - Intergenic
958683402 3:97360093-97360115 GACCTTGCCCTCCAAATATCAGG - Intronic
960796659 3:121495020-121495042 GACTTGGCCTTCCAAAGTGCTGG - Intronic
961039395 3:123666668-123666690 CACCTTGCCTTCTAAACTCCAGG + Intronic
961107177 3:124251898-124251920 GACCTCTCATTGCAAACACCTGG - Intronic
961612916 3:128154696-128154718 GCCCTGGCCTCCCAAAGTCCTGG + Intronic
962127774 3:132640335-132640357 GCCTTGGCCTTCCAAAGTCCTGG + Intronic
962181360 3:133209287-133209309 GCCTTGGCCTTCCAAAGACCTGG + Intronic
966687320 3:182709983-182710005 GCCTTGGCCTTCCAAATTCCTGG - Intergenic
967021861 3:185529638-185529660 GCCCTGGCCTCCCAAACTCTAGG - Intronic
967189492 3:186973283-186973305 GTCTTGGCCTTCCAAACTGCTGG + Intronic
969082693 4:4631962-4631984 GGCCTGGCCTGCCAACCTCCTGG + Intergenic
970325707 4:14921014-14921036 GATCTGTCCTTCCAAACACCTGG - Intergenic
972580775 4:40394050-40394072 GCCTTGGCCTTCCAAAGAGCTGG - Intergenic
973280667 4:48357802-48357824 GACTTGGCCTTCCAAAGTGCTGG + Intronic
979476238 4:121160678-121160700 GAACTGGGCATCCAAACACATGG - Intronic
980422401 4:132580561-132580583 CACAAGGCCGTCCAAACACCTGG - Intergenic
981152277 4:141393018-141393040 GCCCTGGCCTTCCAAAGTGCTGG + Intergenic
981302477 4:143204227-143204249 GCCTTGGCCTTCCAAAGTCCTGG + Intronic
982081307 4:151793063-151793085 GACCTGGCCTTAAAAACTCCAGG - Intergenic
982161559 4:152575440-152575462 GACATGGACTTGCAAACTCCAGG + Intergenic
982490921 4:156028704-156028726 GCCTTGGCCTTCCAAAGAGCTGG - Intergenic
983570106 4:169197373-169197395 GCCCTGGCCTTCCAAAGTGCTGG - Intronic
986438876 5:7760904-7760926 TTCCTGGCCTCCCCAACACCTGG + Intronic
987068239 5:14310279-14310301 CACCTTGCAATCCAAACACCTGG - Intronic
987503199 5:18739589-18739611 GCCTTGGCCTTCCAAAGCCCTGG + Intergenic
987654552 5:20789607-20789629 GCCTAGGCCTTCCAAAGACCTGG - Intergenic
988741089 5:34072235-34072257 GCCTAGGCCTTCCAAAGACCTGG + Intronic
988807592 5:34754742-34754764 GACCTTGTCTTCCAAAGAGCAGG + Intronic
990383231 5:55235101-55235123 GCCCTGGCCTTCCAAAGTGCTGG - Intergenic
991723054 5:69511660-69511682 GCCTTGGCCTTCCAAACCGCTGG + Intronic
991959631 5:72031420-72031442 GACCTGCCCATCCAGCCACCTGG + Intergenic
992840221 5:80682468-80682490 GACTTGGCCTCCCAAACTGCTGG - Intronic
992896617 5:81251345-81251367 GATCTGGCCTTCCAAAGTGCTGG - Intronic
997791650 5:136767495-136767517 GCCTTGGCCTTCCAAAGCCCTGG - Intergenic
998238738 5:140423145-140423167 GCCTTGGCCTTCCAAACTGCTGG + Intronic
998272313 5:140718001-140718023 GACTTGGCCTTCCAAATGGCTGG - Intergenic
999012656 5:148059544-148059566 GCCTTGGCCTTCCAAACTGCTGG - Intronic
999364722 5:151014763-151014785 GACCTGGCCTGGCAAATACTAGG - Intergenic
1000222743 5:159229693-159229715 GCCCTGGCCTTCCAAAGTACTGG - Intergenic
1001502979 5:172253699-172253721 GCCCTGGCCTCCCAAACTGCGGG + Intronic
1001868102 5:175123306-175123328 GACCTTGACTACCAGACACCTGG + Intergenic
1002613596 5:180436861-180436883 GCCCTGGCCTTCCAGAGCCCAGG + Intergenic
1004975828 6:20965059-20965081 GTCTTGGCCTCCCAAACACCTGG - Intronic
1005045093 6:21634364-21634386 GCCCTGGCCTCCCAAAGTCCTGG + Intergenic
1005812976 6:29530450-29530472 GACCTGGCCTTTCCAACCTCGGG - Intergenic
1006632227 6:35437741-35437763 GACTCGGCCTCCCAAACAGCTGG + Intergenic
1006797770 6:36742205-36742227 GCCCTGGCCTCCCATTCACCTGG + Exonic
1007970839 6:46050598-46050620 GCACTGGCCTTCCAAACACAGGG + Intronic
1011020845 6:82810219-82810241 GCCTTGGCCTTCCAAAATCCTGG + Intergenic
1011079716 6:83476196-83476218 GTCTTGGCCTTCCAAACTGCTGG + Intergenic
1011486939 6:87852510-87852532 AACCTGTCCTACCACACACCTGG - Intergenic
1012479190 6:99649370-99649392 GCCCTGGCCTTCCAAAGTGCTGG + Intergenic
1012869013 6:104652002-104652024 CACCTGGCCTCCCAAACTGCTGG - Intergenic
1013035841 6:106381823-106381845 CAACTGGACTTCCAACCACCTGG - Intergenic
1014492921 6:122084188-122084210 GACCTTGTCTTCCAAATATCAGG + Intergenic
1014586819 6:123208138-123208160 GCCCTGGCCTGCCAAAGAGCTGG + Intergenic
1015055735 6:128900900-128900922 GCCTTGGCCTTCCAAAGAGCTGG - Intronic
1015774214 6:136797203-136797225 GCCTTGGCCTTCCAAAGTCCTGG - Intergenic
1017176772 6:151512407-151512429 GCCTTGGCCTTCCAAACTGCTGG + Intronic
1017435653 6:154413477-154413499 GAACTGGCCTTCCAAAGTGCTGG + Intronic
1017767611 6:157619539-157619561 GCCCTGGCCTTGCCACCACCTGG - Intronic
1019257409 7:61105-61127 CACCTGCCCTTTCAAACTCCAGG + Intergenic
1019929000 7:4211106-4211128 GACCTGACCTCCCCAAGACCAGG + Intronic
1020393269 7:7683870-7683892 GCCTTGGCCTCCCAAACAGCTGG + Intronic
1020705404 7:11537761-11537783 GAACTGGCTTTGAAAACACCTGG - Intronic
1021192027 7:17631868-17631890 CACCTGGCCTTCCAAAGTGCTGG + Intergenic
1021338276 7:19431466-19431488 GACTTGGCCTCCCAAACTGCTGG - Intergenic
1021999782 7:26215345-26215367 GCCTTGGCCTTCCAAAGAGCTGG - Intergenic
1022725120 7:32974263-32974285 GCCTTGGCCTTCCAAAGCCCTGG + Intronic
1023682836 7:42705381-42705403 TACCCGGCCCTCCAGACACCTGG + Intergenic
1023860047 7:44213058-44213080 CAGCTGACCATCCAAACACCAGG - Exonic
1023960193 7:44920070-44920092 GCCCTGGCCTCCCAAAGAGCTGG + Intergenic
1024182894 7:46915495-46915517 GCCCTGGCCTCCCAAACTGCTGG + Intergenic
1025048480 7:55713581-55713603 GCCTTGGCCTTCCAAAGCCCTGG - Intergenic
1025125304 7:56339618-56339640 GCCTTGGCCTTCCAAGTACCTGG + Intergenic
1025901043 7:65745098-65745120 GACTTGGCCTTCCAAAGTGCTGG + Intergenic
1026147270 7:67758204-67758226 GCCTTGGCCTTCCAAACTGCTGG + Intergenic
1026948587 7:74332545-74332567 GCCCTGGCCTCCCAAAGAGCTGG + Intronic
1027658655 7:80962416-80962438 GCCCTGGCCTTCCAAAATGCTGG - Intergenic
1027913237 7:84280144-84280166 ACCCTGGCCTTCCAAAGTCCTGG + Intronic
1027943663 7:84718085-84718107 GACTTGGCCTTCCAAAGTGCTGG - Intergenic
1029193245 7:98786537-98786559 GCCTAGGCCTTCCAATCACCTGG + Intergenic
1029416405 7:100445955-100445977 GACCTGGCCTTCCAAAATGCTGG + Intergenic
1029859352 7:103552747-103552769 GCCTTGGCCTCCCAAACTCCTGG + Intronic
1030083463 7:105797556-105797578 AACTTGGGCTTCCAAACTCCAGG - Intronic
1030383140 7:108836142-108836164 GACTTGGCCTCCCAAACTGCTGG + Intergenic
1031078042 7:117231650-117231672 GACCTGGCCTCCCAAATTGCTGG - Intergenic
1032561855 7:132900739-132900761 GACTTGGCCTTCCAAAGTGCTGG - Intronic
1033293737 7:140112358-140112380 GTCTTGGCCTTCCAAAGTCCTGG - Intronic
1033293865 7:140113893-140113915 GCCCTGGCCTTCCAAAGTGCTGG + Intronic
1034132770 7:148735921-148735943 GCCCTGGCCTCCCAAATTCCGGG - Intronic
1034317491 7:150146655-150146677 GGCCTGGCCTTCAAAACATCCGG + Intergenic
1034542498 7:151767538-151767560 GACTTGGCCTTCCAAAGTGCTGG + Intronic
1034633827 7:152551614-152551636 GTCTTGGCCTTCCAAACTCTGGG - Intergenic
1034775260 7:153820570-153820592 GGCCTGGCCTTCAAAACATCCGG - Intergenic
1035163824 7:156971585-156971607 ACCTTGGCCTCCCAAACACCGGG + Exonic
1036200619 8:6768329-6768351 GCCCTGGCCTCCCAAACTGCTGG - Intergenic
1036721333 8:11178084-11178106 AGCCGGGCCTTCCAAACTCCAGG + Intronic
1036804592 8:11821341-11821363 GCCCTGGCCTCCCAAACTGCTGG - Intronic
1038040662 8:23721612-23721634 GCCCTGGCCTCCCAAAATCCTGG + Intergenic
1038277788 8:26136239-26136261 GAACTGGACTCCCAAACTCCTGG - Intergenic
1038511830 8:28144787-28144809 GCCTTGGCCTTCCAAACTGCTGG - Intronic
1038843253 8:31205471-31205493 GACTTGACTTTCCAAACTCCTGG - Intergenic
1038915690 8:32019345-32019367 GCCTTGGCCTCCCAAACAGCAGG + Intronic
1039288661 8:36070081-36070103 GACTTGGCCTCCCAAACTGCTGG - Intergenic
1039615661 8:38953088-38953110 GCCTTGGCCTTCCAAAGTCCTGG + Intronic
1040751440 8:50713808-50713830 GCCCTGGCCTTCCAAAGTGCTGG - Intronic
1042183957 8:66118780-66118802 GAGCTGGTGTTCCAAGCACCAGG - Intergenic
1042296733 8:67227148-67227170 GAACTTGCATTCCAAACAACCGG - Exonic
1042314319 8:67409482-67409504 CACCTGGCCTCCCAAAGCCCTGG - Intergenic
1042653827 8:71072917-71072939 GCCTTGGCCTCCCAAACCCCTGG - Intergenic
1044595132 8:93952351-93952373 GATTTGGCCTTCCAAACTGCTGG + Intergenic
1045233136 8:100325155-100325177 GCCCTGGCCTCCCAAAGTCCTGG + Intronic
1046020149 8:108655353-108655375 AACCTGGCCTCCCAAAGTCCTGG - Intronic
1046545089 8:115639578-115639600 GACTTGGCCTTCCAAAGTGCTGG - Intronic
1046915643 8:119675540-119675562 GCCCTGGCCTCCCAAAGAGCTGG + Intergenic
1047237153 8:123051944-123051966 GACTTGGCCTTCCAAAGTGCTGG + Intronic
1047466063 8:125115499-125115521 GACTTGGCCTTCCAAAGTGCTGG - Intronic
1048279357 8:133093759-133093781 GAAGTGGCCTTTCATACACCTGG - Intronic
1048313023 8:133340510-133340532 GACTTGGCCTTCCAAAGTGCTGG - Intergenic
1050514905 9:6433082-6433104 GCCTTGGCCTTCCAAAGAGCTGG + Intronic
1050891841 9:10834366-10834388 GATCTGACCTTCCAAAAATCAGG + Intergenic
1052912552 9:33896695-33896717 GCCTTGGCCTTCCAAAGTCCTGG + Intronic
1055086380 9:72318238-72318260 TACCTGGCCTCCCAAAGTCCTGG + Intergenic
1055979103 9:81984129-81984151 GCCTTGGCCTTCCAAAATCCTGG - Intergenic
1056467353 9:86870785-86870807 GCCTTGGCCTCCCAAACTCCTGG - Intergenic
1057591013 9:96373437-96373459 GACCTGGCCTCCCAAAGTGCTGG - Intronic
1057709085 9:97420881-97420903 GCCCTGGCCTTCCAAAATGCTGG - Intronic
1058210012 9:102155505-102155527 CACCTAGTCTTCCAAACAGCTGG - Intergenic
1059462523 9:114443059-114443081 GACCTGCTCTTCCAAATACATGG + Intronic
1060098162 9:120812563-120812585 GGCCTGGACTTCCTAACATCTGG + Intergenic
1060513437 9:124250695-124250717 GACTTGGCCTCCCAAAGTCCTGG + Intergenic
1185476310 X:417539-417561 GCCCTGGCCTCCCAAACTGCTGG - Intergenic
1185964542 X:4585891-4585913 GCCCTGGCCTTCCAAAGTACTGG - Intergenic
1187208839 X:17209215-17209237 GATCTGGCCTGCCACACGCCTGG - Intergenic
1188506874 X:30892468-30892490 GACATGGGCCTCCAAACTCCAGG + Intronic
1190636627 X:52441228-52441250 GACCTGGCCTCCCAAAGTGCTGG - Intergenic
1191873672 X:65772260-65772282 GACTTGGCCTTCCAAAGTGCTGG + Intergenic
1193483546 X:82058304-82058326 GACCTGGCCTCCCAAAGTGCTGG + Intergenic
1194590496 X:95794657-95794679 GCCTTGGCCTCCCAAACCCCTGG - Intergenic
1196847129 X:119905209-119905231 GACCAGGCCTTCCTAAGGCCTGG - Intronic
1197737868 X:129865611-129865633 GCCTTGGCCTTCCAAACTGCTGG - Intergenic
1198175631 X:134151655-134151677 GCCATGGCCTTCCAAACTGCTGG - Intergenic
1198447980 X:136737602-136737624 GCCCTGGCCTTCCAAAGTGCTGG - Intronic
1198535148 X:137577900-137577922 CCCCTGGCCTTCCCAACACCTGG - Intergenic
1199843554 X:151674633-151674655 GGCCTGCCCTTCCAAATACGGGG - Intronic
1200425863 Y:3019769-3019791 GCCCTCGTGTTCCAAACACCTGG + Intergenic
1201890115 Y:18934326-18934348 GCCTTGGCCTTCCAAACTGCTGG - Intergenic