ID: 1066705259

View in Genome Browser
Species Human (GRCh38)
Location 10:38170897-38170919
Sequence GAGGGAGAAAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066705259_1066705267 12 Left 1066705259 10:38170897-38170919 CCTTCCTCCTTCTTTTCTCCCTC No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data
1066705259_1066705262 -8 Left 1066705259 10:38170897-38170919 CCTTCCTCCTTCTTTTCTCCCTC No data
Right 1066705262 10:38170912-38170934 TCTCCCTCTACCCTATTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066705259 Original CRISPR GAGGGAGAAAAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr