ID: 1066705267

View in Genome Browser
Species Human (GRCh38)
Location 10:38170932-38170954
Sequence TGGAATGAAGATCCAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066705258_1066705267 24 Left 1066705258 10:38170885-38170907 CCTTCTAAAAAACCTTCCTCCTT No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data
1066705264_1066705267 -7 Left 1066705264 10:38170916-38170938 CCTCTACCCTATTGTCTGGAATG No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data
1066705260_1066705267 8 Left 1066705260 10:38170901-38170923 CCTCCTTCTTTTCTCCCTCTACC No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data
1066705259_1066705267 12 Left 1066705259 10:38170897-38170919 CCTTCCTCCTTCTTTTCTCCCTC No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data
1066705263_1066705267 -6 Left 1066705263 10:38170915-38170937 CCCTCTACCCTATTGTCTGGAAT No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data
1066705261_1066705267 5 Left 1066705261 10:38170904-38170926 CCTTCTTTTCTCCCTCTACCCTA No data
Right 1066705267 10:38170932-38170954 TGGAATGAAGATCCAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066705267 Original CRISPR TGGAATGAAGATCCAATAGC TGG Intergenic
No off target data available for this crispr