ID: 1066708046

View in Genome Browser
Species Human (GRCh38)
Location 10:38202509-38202531
Sequence CTGTGGTTGTATGAGTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066708046_1066708050 -9 Left 1066708046 10:38202509-38202531 CCGGGGCACTCATACAACCACAG No data
Right 1066708050 10:38202523-38202545 CAACCACAGCAGCACTTTGGGGG No data
1066708046_1066708049 -10 Left 1066708046 10:38202509-38202531 CCGGGGCACTCATACAACCACAG No data
Right 1066708049 10:38202522-38202544 ACAACCACAGCAGCACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066708046 Original CRISPR CTGTGGTTGTATGAGTGCCC CGG (reversed) Intergenic
No off target data available for this crispr