ID: 1066708113

View in Genome Browser
Species Human (GRCh38)
Location 10:38203162-38203184
Sequence CACAGCTGGGACATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066708113_1066708123 -3 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708123 10:38203182-38203204 GTGGACCTGTGGTGAGGAGAGGG No data
1066708113_1066708130 16 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708130 10:38203201-38203223 AGGGGCTACATGCTTGGGGGAGG No data
1066708113_1066708121 -9 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708121 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
1066708113_1066708122 -4 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708122 10:38203181-38203203 TGTGGACCTGTGGTGAGGAGAGG No data
1066708113_1066708127 11 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708127 10:38203196-38203218 AGGAGAGGGGCTACATGCTTGGG No data
1066708113_1066708126 10 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708126 10:38203195-38203217 GAGGAGAGGGGCTACATGCTTGG No data
1066708113_1066708131 17 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708131 10:38203202-38203224 GGGGCTACATGCTTGGGGGAGGG No data
1066708113_1066708124 -2 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708124 10:38203183-38203205 TGGACCTGTGGTGAGGAGAGGGG No data
1066708113_1066708129 13 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708129 10:38203198-38203220 GAGAGGGGCTACATGCTTGGGGG No data
1066708113_1066708128 12 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066708113 Original CRISPR CACAGCTGGGACATGGGGAA AGG (reversed) Intergenic