ID: 1066708120

View in Genome Browser
Species Human (GRCh38)
Location 10:38203176-38203198
Sequence CCTCACCACAGGTCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066708120_1066708128 -2 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708120_1066708126 -4 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708126 10:38203195-38203217 GAGGAGAGGGGCTACATGCTTGG No data
1066708120_1066708130 2 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708130 10:38203201-38203223 AGGGGCTACATGCTTGGGGGAGG No data
1066708120_1066708129 -1 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708129 10:38203198-38203220 GAGAGGGGCTACATGCTTGGGGG No data
1066708120_1066708131 3 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708131 10:38203202-38203224 GGGGCTACATGCTTGGGGGAGGG No data
1066708120_1066708127 -3 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708127 10:38203196-38203218 AGGAGAGGGGCTACATGCTTGGG No data
1066708120_1066708132 21 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487
1066708120_1066708133 22 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066708120 Original CRISPR CCTCACCACAGGTCCACAGC TGG (reversed) Intergenic
No off target data available for this crispr