ID: 1066708128

View in Genome Browser
Species Human (GRCh38)
Location 10:38203197-38203219
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066708116_1066708128 6 Left 1066708116 10:38203168-38203190 CCCATGTCCCAGCTGTGGACCTG No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708120_1066708128 -2 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708111_1066708128 16 Left 1066708111 10:38203158-38203180 CCACCCTTTCCCCATGTCCCAGC No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708112_1066708128 13 Left 1066708112 10:38203161-38203183 CCCTTTCCCCATGTCCCAGCTGT No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708115_1066708128 7 Left 1066708115 10:38203167-38203189 CCCCATGTCCCAGCTGTGGACCT No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708119_1066708128 -1 Left 1066708119 10:38203175-38203197 CCCAGCTGTGGACCTGTGGTGAG No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708117_1066708128 5 Left 1066708117 10:38203169-38203191 CCATGTCCCAGCTGTGGACCTGT No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data
1066708113_1066708128 12 Left 1066708113 10:38203162-38203184 CCTTTCCCCATGTCCCAGCTGTG No data
Right 1066708128 10:38203197-38203219 GGAGAGGGGCTACATGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066708128 Original CRISPR GGAGAGGGGCTACATGCTTG GGG Intergenic