ID: 1066708132

View in Genome Browser
Species Human (GRCh38)
Location 10:38203220-38203242
Sequence GAGGGAGAGCACAGCAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 8, 1: 18, 2: 67, 3: 143, 4: 487}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066708115_1066708132 30 Left 1066708115 10:38203167-38203189 CCCCATGTCCCAGCTGTGGACCT No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487
1066708117_1066708132 28 Left 1066708117 10:38203169-38203191 CCATGTCCCAGCTGTGGACCTGT No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487
1066708120_1066708132 21 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487
1066708116_1066708132 29 Left 1066708116 10:38203168-38203190 CCCATGTCCCAGCTGTGGACCTG No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487
1066708125_1066708132 10 Left 1066708125 10:38203187-38203209 CCTGTGGTGAGGAGAGGGGCTAC No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487
1066708119_1066708132 22 Left 1066708119 10:38203175-38203197 CCCAGCTGTGGACCTGTGGTGAG No data
Right 1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG 0: 8
1: 18
2: 67
3: 143
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066708132 Original CRISPR GAGGGAGAGCACAGCAACTG TGG Intergenic
900291244 1:1924411-1924433 GAGGGCGAGCTGAGGAACTGCGG + Exonic
900571162 1:3358943-3358965 GGGGGAAAGCACAGCCGCTGTGG + Intronic
901450347 1:9332898-9332920 GACGGAGACCACAGGAAGTGTGG + Intronic
902383658 1:16064466-16064488 GAGGGAGAGCAGAGCCTCTGGGG - Intronic
902922082 1:19672107-19672129 GAGGGAGAGCCCAGCAGGAGAGG + Intronic
904207654 1:28865198-28865220 GAGGGAGGGGACAGCAGCGGAGG - Intergenic
904652149 1:32013850-32013872 GAGAGAGAGCACCGGAAATGAGG - Exonic
905285719 1:36879032-36879054 AAGGGAGAGAAGAGCCACTGAGG - Intronic
905739815 1:40360691-40360713 GAAGGAGAGCACAGTGATTGTGG + Intronic
905873241 1:41416706-41416728 GAGGCAGAGCAAAGCAACACGGG - Intergenic
906564946 1:46792679-46792701 GAGGGAAACAACAGCCACTGGGG + Intronic
906686597 1:47767096-47767118 GAGGGAGTGCACAACTACAGAGG + Intronic
907307896 1:53523693-53523715 GAGGGACAGGACTGCAGCTGGGG - Intronic
907795166 1:57708734-57708756 GAGAGAGAGCAAAGCAAGAGTGG - Intronic
908397694 1:63741213-63741235 GAGGGAGAGCACAGTGATTGTGG - Intergenic
909309701 1:74130409-74130431 GAGTGAGAACACAGTAATTGTGG - Intronic
909848911 1:80434819-80434841 GAGGGAGATCTCAGTGACTGGGG - Intergenic
910422436 1:87080767-87080789 GGGGGAGAGCACAGTGATTGCGG + Intronic
910470526 1:87547746-87547768 GAGGGAGAGGACAGTGACTGTGG - Intergenic
910600442 1:89026093-89026115 GAATGAGAGCAGAGCAAATGGGG + Intergenic
910785802 1:90997047-90997069 GAGGGAGAGAAGAACAGCTGAGG + Intronic
910819933 1:91335788-91335810 GATTCAGAGCACAGCAGCTGGGG - Intronic
911344101 1:96675128-96675150 GAGGGAGAGCACAGTGATTGTGG - Intergenic
911667846 1:100574351-100574373 GAGGGAAAGAACAGACACTGGGG + Intergenic
912152643 1:106879442-106879464 GAGGGAGAGTGCAGCAACTTGGG + Intergenic
912316310 1:108670253-108670275 GTGGGAGAGCACAGTGACTGGGG + Intergenic
912601012 1:110933544-110933566 GAGGGAGAGCACAGCAATTGCGG + Intergenic
912643820 1:111372274-111372296 AAGGGAGAGCACAGTGATTGTGG + Intergenic
912871406 1:113310479-113310501 GAGGGAGAGCACAGGGATTGTGG + Intergenic
914717980 1:150267462-150267484 GAAGGAGAGACCAGAAACTGGGG + Exonic
914799885 1:150953130-150953152 GAGGTTGAGGACAGCTACTGAGG + Intronic
914831544 1:151174335-151174357 GAGAGACAGCACAGCCACTTGGG + Intronic
915042930 1:152983639-152983661 GAGGGGGAGCAGAGGAGCTGAGG - Intergenic
915693758 1:157717118-157717140 GAGGGAAAGCACAGTGACTAGGG - Intergenic
916527045 1:165620141-165620163 CAGGGAGAGGACAGAAAATGTGG + Intergenic
917191250 1:172421846-172421868 GAGGGAGGGCACAGCGATTGTGG + Intronic
917246356 1:173005151-173005173 GAGGGAGAGCACAGCAAATTGGG - Intergenic
917300676 1:173570833-173570855 AAGGGAGACCACAGCAACTGGGG - Intronic
917306126 1:173627466-173627488 GAGGGAGAGCACAGTGACTGTGG + Intronic
917373211 1:174317942-174317964 GAGGGAGAACACAGCAACTGTGG - Intronic
917397038 1:174604347-174604369 GAGGGAGAGGACAGTGATTGTGG - Intronic
918357891 1:183723504-183723526 GAGGGAGAGTACAGTGACTGTGG + Intronic
919012933 1:191988479-191988501 AAGGGAGAACACAGCAACTGGGG + Intergenic
919147337 1:193651936-193651958 AAGGGAGAGCACAGTAACTGTGG - Intergenic
919169704 1:193938552-193938574 GGGGGAGAGTGCAGCAATTGTGG + Intergenic
919984786 1:202665701-202665723 GAGGGAGAGAAGAGCAAATGAGG - Intronic
920246557 1:204592211-204592233 GAGTGACAGCCCAGCCACTGGGG + Intergenic
920596828 1:207280193-207280215 GAGGGAGAGCACAGTTACTGTGG - Intergenic
921561274 1:216661315-216661337 GATAGAGAGCACAGCAAATTTGG - Intronic
921929504 1:220743557-220743579 GAGGAAGAGCACAGCGATTGTGG - Intergenic
922388660 1:225114777-225114799 GAGAGAGAGCACAGTGACTGTGG - Intronic
923102316 1:230826400-230826422 GAGAAAGAGCACAGCAAGAGGGG + Intergenic
923685531 1:236150863-236150885 GAGGGTGGGCACAGCAGCAGCGG - Intronic
924190623 1:241548401-241548423 GAGGAAGAGGACTGTAACTGGGG + Intronic
924516320 1:244769012-244769034 GAGGGAGAGCGCAGTGACTGGGG - Intergenic
924943594 1:248829789-248829811 GAGGGAGAGCTCGGCATCAGAGG - Intergenic
1062800814 10:379100-379122 GACAGAGGGCACAGCACCTGCGG + Intronic
1064318235 10:14277690-14277712 GAGGGAGGGGAAAGTAACTGTGG - Intronic
1064521725 10:16209893-16209915 GAGGAAGAGCACAGTGACTGGGG - Intergenic
1064707092 10:18084423-18084445 GGGGGAGATCACAGCAAGGGTGG - Intergenic
1065176130 10:23077188-23077210 GGGGCAGAGAACAGCTACTGAGG + Intergenic
1065921715 10:30398958-30398980 AAGGGAGAGTGCAGCAATTGTGG + Intergenic
1066143105 10:32527215-32527237 GAGGGAGAGCACAACAGTGGGGG - Intronic
1066708132 10:38203220-38203242 GAGGGAGAGCACAGCAACTGTGG + Intergenic
1066981376 10:42419363-42419385 GATGGAGAGCACAGCAACTGTGG - Intergenic
1068124900 10:52827523-52827545 GAGGGAGAGCAAAGTGACTGTGG + Intergenic
1068789722 10:61014395-61014417 GAGGGAAAACACAGGAACTAAGG - Intergenic
1068890545 10:62144363-62144385 GAGGGAAAGAACAGACACTGGGG + Intergenic
1069050570 10:63788304-63788326 GAGGGAGAGCACAGTGACTGGGG + Intergenic
1070059557 10:72968676-72968698 GAGGGAAAGTACAGTAACTGGGG - Intergenic
1070818911 10:79343404-79343426 GTGTGAGAGCCCAGCAGCTGAGG + Intergenic
1070819784 10:79347993-79348015 GAGGGAGGGCTCAGCACCTCTGG + Intronic
1071348380 10:84715085-84715107 GAGGGACAGCAGGGAAACTGGGG + Intergenic
1071733306 10:88270443-88270465 GAGGCACAAGACAGCAACTGAGG - Intergenic
1071935636 10:90527062-90527084 GAGGGAGAGTACAGGATTTGTGG - Intergenic
1072842933 10:98795367-98795389 GAGAGACAGCACAGCAGATGGGG + Intronic
1073827213 10:107337479-107337501 GAGGGAGATCACAGTGACTGGGG - Intergenic
1073870790 10:107861869-107861891 TAGGGAGAGCTCAGCAGCTTTGG - Intergenic
1073970139 10:109038487-109038509 TAGGGAGGGCAAAGCAACAGGGG - Intergenic
1074603859 10:114941045-114941067 GAGGGAAAACAAAGCAACAGTGG - Intronic
1074670050 10:115780153-115780175 GAGGGAGAGCACAGTGATTGTGG + Intronic
1074773556 10:116749257-116749279 TAGGAAGAGCCCAGCAAGTGAGG - Intergenic
1075135483 10:119781716-119781738 AAGTGAGAGCACAGCAATTTTGG - Exonic
1076117005 10:127907558-127907580 GAGCGTGAGCACTGCCACTGTGG - Intronic
1076197901 10:128533266-128533288 GAGGGAGGGCAAAGAAACTAAGG + Intergenic
1076383852 10:130043636-130043658 GCGGGAGAGCAGGGCACCTGGGG - Intergenic
1076386799 10:130062913-130062935 GAGGGAGGGCACTGACACTGAGG + Intergenic
1077340689 11:2025068-2025090 GAGAGAGGGCACAGGAACGGGGG - Intergenic
1077372543 11:2190172-2190194 CTGGGAGTGCACAGCCACTGAGG + Intergenic
1077373469 11:2194470-2194492 GAGGGAGGGGACAGCAGATGGGG + Intergenic
1077842470 11:5990656-5990678 GAGGGAGGGCACAGAAAGAGTGG + Intergenic
1077858764 11:6156803-6156825 GAGGAAGAGCGCAGCGATTGTGG + Intergenic
1078357184 11:10641370-10641392 TTGGGAGAGCCCAGCCACTGTGG + Intronic
1078843195 11:15097727-15097749 GAGGGAGAGCACAGTCATCGTGG - Intergenic
1078896318 11:15600305-15600327 GAGGGAGAGAACAGGAGCTGGGG - Intergenic
1079416300 11:20239183-20239205 GAAGGAGAGCACAGTGACTGGGG - Intergenic
1079486372 11:20939825-20939847 GAGGGAGTGAAGAGCAAATGGGG + Intronic
1079520430 11:21319993-21320015 GAGGGAGAGTATAGGAATTGGGG + Intronic
1081073825 11:38643155-38643177 GAAGGAGAACAAAGCAAATGTGG - Intergenic
1083512888 11:63227936-63227958 GAGGAAGAGCACAGCAATTACGG - Intronic
1083953582 11:65970551-65970573 TGGGGAGGGCACAGCAGCTGTGG + Intronic
1084149593 11:67281982-67282004 GAAGGAGAGGACAGCCACGGAGG - Intronic
1084421606 11:69063290-69063312 GAGGCAGGGCACAGCCACAGAGG - Intronic
1085194852 11:74662958-74662980 GAGGGAGAGTGCAGCAACTGTGG - Intronic
1085223331 11:74895258-74895280 GATGGAGAGCACAGCAACCGAGG + Intronic
1085372404 11:76021023-76021045 GAGGGAGAGCACAGCGATTGTGG - Intronic
1085459428 11:76684593-76684615 AAGGGAGAGCACAGCAACAAGGG - Intergenic
1085461654 11:76697559-76697581 GTGGGCAAGGACAGCAACTGGGG - Intergenic
1085562662 11:77486631-77486653 GAGGGAAAGCACAGTGATTGTGG + Intergenic
1086032989 11:82383212-82383234 GAGGGAGAGCACAGCAACTGAGG + Intergenic
1086269205 11:85039966-85039988 GATGGAGAGAACACCATCTGGGG + Intronic
1087299188 11:96412964-96412986 GAGGAAGAGCACAGCAATTAAGG + Intronic
1087614281 11:100470471-100470493 CAAGGAGGGCACAGAAACTGAGG + Intergenic
1088009721 11:104985678-104985700 GAGGGAGAGTACAGCATCTGAGG + Intergenic
1088135921 11:106555114-106555136 GAAGGAGAGCACAGTGACTAGGG - Intergenic
1088330637 11:108647590-108647612 GAGGGAGAGCAAAGTGAGTGTGG + Intergenic
1088391532 11:109320170-109320192 AATGGAAAGCACAGCAACTATGG + Intergenic
1088569813 11:111212527-111212549 GAGGGAGAGCACAGCAATTGTGG + Intergenic
1088944583 11:114496314-114496336 AAGGGAGAGCACAGTGATTGTGG - Intergenic
1089103402 11:115982805-115982827 GAGGGAGAGTACAACAGATGTGG + Intergenic
1089236390 11:117029973-117029995 GAGGGAGAGCACAGAACCTAAGG + Intronic
1089812051 11:121140369-121140391 GAGGGAGAGCTAACCCACTGGGG - Intronic
1091275963 11:134350426-134350448 AAGGGAGAGCACAGTGACTGGGG - Intronic
1091348693 11:134874971-134874993 GAGAGAGGGCAAAGCCACTGTGG - Intergenic
1202823674 11_KI270721v1_random:80257-80279 GAGAGAGGGCACAGGAACGGGGG - Intergenic
1091386461 12:99109-99131 GAGGGAGATCAGAGCGCCTGAGG - Intronic
1091728761 12:2864552-2864574 GAAGGAGAGCAAAGCTCCTGGGG - Intronic
1092477142 12:8828951-8828973 GCGGGAGAGCACAGTGACTGTGG - Intronic
1093321383 12:17719090-17719112 GAGAGAGAGCCCAGTGACTGTGG - Intergenic
1093581731 12:20791195-20791217 GAGGGAAAGAACAGCAACTGGGG - Intergenic
1093931625 12:24960328-24960350 GAGGAAGAGCACAGTGACTGTGG + Intergenic
1094816145 12:34186771-34186793 GAGGGAGAGCACAACTTGTGAGG - Intergenic
1095100952 12:38183499-38183521 GAGGAAGAGCACAGTTTCTGAGG + Intergenic
1095163212 12:38941087-38941109 GAGGAAGAGCACAGTGACTGTGG + Intergenic
1095181824 12:39154806-39154828 GAGGGAGAGCACAGCAATTGTGG - Intergenic
1096321804 12:50620790-50620812 AAGGGAGAGCACAGAACCTCTGG - Intronic
1097288002 12:57892470-57892492 GTGGGAGAGGAGAGCAGCTGTGG + Intergenic
1097569095 12:61308722-61308744 GTGGGAGAGCGCAGTGACTGAGG - Intergenic
1098544293 12:71694290-71694312 GTGGAAGAGCACAGCAAGAGGGG + Intronic
1098736730 12:74113852-74113874 GAGGGAGAGCACAGCAATTATGG - Intergenic
1098975249 12:76895753-76895775 GAGGGAGAGCAAAGAGAGTGTGG + Intergenic
1099101012 12:78440095-78440117 GAGGGAGAGCAAAGTGACTGTGG - Intergenic
1099119113 12:78665606-78665628 GAGGGAGAGTGCAGCAACCGGGG - Intergenic
1099757786 12:86876892-86876914 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1099764264 12:86961628-86961650 GAGGGAGAACACAGCATTTGGGG - Intergenic
1100455811 12:94750555-94750577 GAGGGAGGGCCCAGCATCTAGGG + Intergenic
1100701661 12:97154975-97154997 GAGAGAAAGGACAGCAGCTGAGG - Intergenic
1101003088 12:100375582-100375604 GATTCAGAGCACAGCAGCTGGGG + Intronic
1101607373 12:106257892-106257914 GAGGGACAGGACAGCAATTAGGG + Intronic
1101939452 12:109089234-109089256 GAGGGAGAGCAGAGGGACTCTGG - Intronic
1102417904 12:112780369-112780391 GAGGGAAAGAACAGGCACTGGGG - Intronic
1103190681 12:118999220-118999242 GAGGGAGAGTCCTGCACCTGGGG + Intronic
1103830743 12:123777134-123777156 GAGGGTAAGAACAGAAACTGAGG - Intronic
1104848945 12:131861946-131861968 GAGGGAGAAGAGAGCAAGTGAGG + Intergenic
1105815777 13:24034954-24034976 GAGAGAGTTCAAAGCAACTGTGG + Intronic
1106026505 13:25960420-25960442 GAGGGAGAGCAGAGGGCCTGAGG - Intronic
1106273596 13:28180174-28180196 GAAGGACACCACAGCAACTATGG - Intronic
1106350214 13:28922632-28922654 GAGGGAGAGCGCAATGACTGGGG - Intronic
1107524318 13:41214710-41214732 GAGGGAAAGCACAGCAATTTTGG - Intergenic
1108256056 13:48612088-48612110 GAGGGTGAGCACCACAACTGTGG - Intergenic
1108273978 13:48789496-48789518 GAGGCAGGTGACAGCAACTGAGG - Intergenic
1108459102 13:50647337-50647359 GAGGGAGACCATGGCACCTGTGG + Intronic
1108532107 13:51337134-51337156 AAGAGAGAGCACACCCACTGAGG - Intronic
1108879152 13:55087630-55087652 GAGAGAGAGCACAGTTACTGTGG - Intergenic
1109211363 13:59538963-59538985 GAGGGAAAGCGCAGTGACTGGGG - Intergenic
1109566902 13:64130420-64130442 GAAGGAGAATGCAGCAACTGGGG + Intergenic
1109961761 13:69640025-69640047 GAGGGAGAGCACAATGATTGCGG - Intergenic
1110067049 13:71121483-71121505 GAGGGGGACTAAAGCAACTGAGG - Intergenic
1110233041 13:73186422-73186444 GAGGGAGAGTAAAGCAATTAGGG + Intergenic
1111639192 13:90946624-90946646 GAGGGAGAGCATAGTGATTGTGG + Intergenic
1111713506 13:91847915-91847937 GATGGAGAGTACAGAAATTGAGG - Intronic
1111750497 13:92325424-92325446 CAGGAATAACACAGCAACTGTGG - Intronic
1112142789 13:96664407-96664429 ATGGCACAGCACAGCAACTGGGG - Intronic
1112304483 13:98261296-98261318 GTGGGTGACTACAGCAACTGGGG + Intronic
1112387110 13:98949930-98949952 GACAGACAGCACAGCAATTGAGG - Intronic
1112700947 13:102007259-102007281 GAGGGAGATCATCACAACTGAGG - Intronic
1112944500 13:104910749-104910771 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1112999385 13:105615998-105616020 GAGGGAGAAAAAAGCAAATGTGG + Intergenic
1113244429 13:108378254-108378276 AAGGGATAGCACAGTGACTGTGG - Intergenic
1113253829 13:108485644-108485666 GAGAGGGAGTACAGAAACTGGGG + Intergenic
1113602831 13:111582863-111582885 CAGGGAAAGCACAGCAGCTGGGG - Intergenic
1114155560 14:20099386-20099408 GAATTAGAGCACAGCAACGGTGG - Intergenic
1114247965 14:20932702-20932724 GAGGGAGAGTTTAGCAATTGTGG + Intergenic
1114250797 14:20958801-20958823 GAGGGACAGTGCAGCAATTGTGG + Intergenic
1114405127 14:22449304-22449326 GAGTGAGAGGTCAGCAGCTGTGG - Intergenic
1114700936 14:24678333-24678355 GACTGAGAGCACAGCAACCCTGG + Intergenic
1114783848 14:25570959-25570981 TTGGGAGAGCACAGTTACTGGGG - Intergenic
1115133882 14:30086205-30086227 GAGGGAGAGCACAGTGACTGGGG + Intronic
1115782816 14:36788544-36788566 GTGGAAAACCACAGCAACTGAGG + Intronic
1115925255 14:38425805-38425827 GAGGAAGAGCACAGTGATTGTGG - Intergenic
1116275724 14:42828431-42828453 GAGGGAGACCACAGTGATTGTGG - Intergenic
1116504907 14:45665909-45665931 GAGGAAGAACACAGCAATTGTGG - Intergenic
1117161618 14:52995342-52995364 GAGGGAGAGCACAGTGACTATGG - Intergenic
1117208573 14:53470824-53470846 GAGAGAGAGCACAGTGATTGTGG - Intergenic
1117634745 14:57730014-57730036 GAGGGAGGGCACAGGAACTGGGG - Intronic
1117997441 14:61490977-61490999 GAGAGAGTGCACAGTAACTCAGG - Intronic
1118034283 14:61849624-61849646 GAGGGAGAGCATAGTGATTGTGG - Intergenic
1118241277 14:64060930-64060952 GAGGGAAAGCGCAGCAACTGGGG - Intronic
1118431285 14:65720950-65720972 GAGGGGGAGCACAGTGATTGTGG - Intronic
1119183131 14:72617722-72617744 GAGGGACAGCACAAATACTGCGG + Intergenic
1120275598 14:82369600-82369622 GGGAGGGAGCACAGCAAATGGGG + Intergenic
1122263518 14:100536300-100536322 CAGGGAGAGCGCAGCAACCACGG + Intergenic
1123112531 14:105880035-105880057 CAGGGAGAGCAGGGCAGCTGGGG + Intergenic
1123216311 14:106812721-106812743 GATGGAGAACACTGCAGCTGTGG + Intergenic
1124221167 15:27851039-27851061 GAGAAAGAGAACTGCAACTGAGG + Intronic
1124847796 15:33309269-33309291 GACGGAGAGCACAACAATTCAGG + Intergenic
1125429704 15:39581994-39582016 GAGGGAGAGGACAGCACGTGAGG - Intronic
1125790294 15:42360314-42360336 GAGGGAGAGCGCAGGAGGTGGGG + Intronic
1125920123 15:43520418-43520440 GAAGGAGAGGACAGCCAGTGTGG + Intronic
1126706748 15:51413489-51413511 GAGGGAGAGGACAGTAATTGTGG + Intergenic
1126936164 15:53710873-53710895 GAAGTAGAGCACAGTAAATGAGG + Exonic
1127155878 15:56123856-56123878 GAGAGAGAGTGCAGCAGCTGTGG - Intronic
1127971647 15:63966734-63966756 GAGGGAGAGTGCAGCAATTGTGG - Intronic
1128356039 15:66927289-66927311 CAGGGACAGCAAAGCAACAGGGG + Intergenic
1128791595 15:70438482-70438504 GAGGCAGACCCCAGAAACTGGGG + Intergenic
1129030752 15:72616018-72616040 GAGGGAGAATGCAGCAACTGTGG - Intergenic
1129235615 15:74222118-74222140 GGGGGAGACCACAACAGCTGTGG + Intergenic
1129477595 15:75796542-75796564 GAGGGAGAATACAGCAACTGTGG - Intergenic
1129584488 15:76848997-76849019 GAGGGATAGCACTGTTACTGTGG - Intronic
1129741428 15:77991473-77991495 GGGGCAGAGAACAGAAACTGAGG + Intronic
1129835662 15:78703819-78703841 GAGGGAGAATGCAGCAACTGTGG - Intronic
1129844235 15:78760934-78760956 GGGGCAGAGAACAGAAACTGAGG - Intronic
1130441260 15:83956218-83956240 GAGGGAGAGCACAGCAACTGGGG - Intronic
1130511673 15:84594817-84594839 GAGGGAGAATGCAGCAACTGTGG + Intergenic
1130597374 15:85257099-85257121 GGGGCAGAGAACAGGAACTGAGG - Intergenic
1131335517 15:91545100-91545122 CATTTAGAGCACAGCAACTGGGG + Intergenic
1131699708 15:94921207-94921229 GAGAGAGAAGACAGCAAATGGGG + Intergenic
1133988333 16:10685240-10685262 GAGAGAGATGAGAGCAACTGAGG - Intronic
1134027835 16:10967983-10968005 GATGGGGAGCACAGCAACCCCGG - Intronic
1134460690 16:14427011-14427033 GTGGGGGTGCCCAGCAACTGAGG - Intergenic
1136071203 16:27788350-27788372 GAGGAAGATCACCGCAACTATGG - Exonic
1136389300 16:29952304-29952326 GAGAGAGAGCACATGGACTGGGG - Intronic
1136676616 16:31914176-31914198 GACGGAGAGCACAGTGACTAGGG - Intronic
1136679123 16:31945056-31945078 GAGGGAGATTGCAGCAACTGGGG + Intergenic
1138595665 16:58027752-58027774 GAGGGAGGGCAGAGCAGGTGGGG - Intronic
1138806934 16:60100907-60100929 GAGAGCGAGCACAGTGACTGTGG - Intergenic
1139005042 16:62559488-62559510 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
1139691172 16:68642967-68642989 GCGGGTGAGCCCAGCAGCTGGGG - Intronic
1141267084 16:82507261-82507283 GAGGGAGAACAAGGCAACTGGGG - Intergenic
1143030748 17:3965605-3965627 GAGGAAGAGCACAGAATCTGGGG - Intergenic
1145069084 17:19787909-19787931 GAGGGAGAGTGCAGCAATTTGGG + Intronic
1145933789 17:28703485-28703507 GAGGGAGAGAACAGCAGCAGAGG + Exonic
1146098966 17:29960134-29960156 CAGGGAGAGCACAGTGACTGTGG - Intronic
1146164880 17:30579968-30579990 GGGGGACAGCACAGCATCAGTGG - Intergenic
1146594020 17:34154422-34154444 GAGGAAGAGCACAGCAAAATCGG - Intronic
1148211963 17:45813983-45814005 GAGGCAGAGGCCAGCCACTGAGG - Intronic
1148328980 17:46801774-46801796 GAGGGAGGGCAGTGCCACTGTGG + Intronic
1149188435 17:54029952-54029974 GAGAGAGAGCACAGTGATTGTGG + Intergenic
1150870896 17:68910320-68910342 GAGGGAGAGGACAGTCATTGTGG + Intronic
1151158116 17:72141644-72141666 GAGTGTCAGCAGAGCAACTGTGG - Intergenic
1151255592 17:72873942-72873964 GAGTGAGAGCTGAGCAAGTGGGG - Intronic
1151699181 17:75733689-75733711 AATGGTGAGCACAACAACTGCGG + Exonic
1152143070 17:78549930-78549952 GAGAGAGAGAACAGCCACAGAGG + Intronic
1152274131 17:79344447-79344469 GAGGGAGAGGGCAGCAGCTCTGG - Intronic
1152324186 17:79626126-79626148 GTGGGAGAACACAGGAAGTGGGG + Intergenic
1152794966 17:82302234-82302256 GAGGGGGGGCCCAGAAACTGGGG - Intergenic
1152901189 17:82941949-82941971 GAGAGACAGCACAGCAACCCTGG - Intronic
1203162234 17_GL000205v2_random:63094-63116 GAGGGAAAGTGCAGCACCTGTGG - Intergenic
1153356708 18:4144414-4144436 GAGGGAGAACACAGTGATTGTGG - Intronic
1153429353 18:4999139-4999161 GAGGGAGAGTGCAGTGACTGAGG + Intergenic
1153700598 18:7689381-7689403 GAGGGAGGGCATTGCTACTGTGG - Intronic
1153849810 18:9082822-9082844 GAGGGGGAGAAAAGCCACTGTGG + Intergenic
1154085984 18:11305890-11305912 GAGGGAGAGCACAGCAACTGGGG - Intergenic
1154173276 18:12066386-12066408 GAGGGGGAGCGGAGCACCTGAGG - Intergenic
1154334130 18:13452403-13452425 GAGGGATAGCTCAGCAAAGGTGG + Intronic
1155443291 18:25884415-25884437 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1155792756 18:29995470-29995492 GAGGGAGCGCATAGTGACTGTGG + Intergenic
1155868598 18:30997395-30997417 GAGGGAGAGAGGAGCAACAGGGG + Intronic
1156477992 18:37418382-37418404 AAGAGAGAGCAGAGCCACTGGGG - Intronic
1158025100 18:52886465-52886487 GACAGACAGCACAGCGACTGGGG - Intronic
1158116741 18:54004657-54004679 GAGGCAGAGCACAGCTATTAAGG + Intergenic
1158607459 18:58908254-58908276 GTGGGAGAGCACAACACCCGTGG - Intronic
1158946821 18:62454176-62454198 GAGGAAGGCCACAGCATCTGTGG + Intergenic
1159080517 18:63730757-63730779 GAGGGAGAGTGCAGCAACTTGGG + Intergenic
1159564855 18:70036978-70037000 GAGGGAGAGAGCAGCGACTGGGG + Intronic
1159802681 18:72920396-72920418 GAGGGAGAGCACAGTCATTATGG - Intergenic
1160174206 18:76579598-76579620 GAGGGAGAGGAAGGGAACTGTGG - Intergenic
1160196007 18:76756001-76756023 GGGGGAGAGCACTGCACATGTGG + Intergenic
1160333862 18:78019208-78019230 GAGGGAGTAGACAGCCACTGAGG - Intergenic
1161030144 19:2054236-2054258 GTGGGAGAGGACAGGACCTGGGG - Intergenic
1162596030 19:11629986-11630008 GAGGGAGAGCGCAGTGATTGTGG + Intergenic
1164609530 19:29622698-29622720 TTGGGAGAGCAGGGCAACTGAGG - Intergenic
1164738481 19:30559690-30559712 GAGGGAGTGCAAAGCCAGTGAGG + Intronic
925082167 2:1078858-1078880 GAGGAAGGTCACAGGAACTGAGG + Intronic
926304160 2:11625953-11625975 GAGTGAGAGCCCAGCAAAAGGGG + Intronic
926516249 2:13850644-13850666 AAGAGAGAGCACAGTAATTGTGG + Intergenic
926518749 2:13883411-13883433 GAGGGAGAGCACAGTGATTGCGG + Intergenic
927196626 2:20552145-20552167 GAGGCAGAGCCCAGCAAGGGTGG - Intergenic
928336911 2:30406088-30406110 GAGGAAGAGAACAGCCTCTGTGG - Intergenic
928483955 2:31710991-31711013 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
928847611 2:35696690-35696712 GAGGGAGAGCAAAGTGACTGGGG - Intergenic
929765853 2:44843649-44843671 GAGAGAGAGGAAAGCAATTGGGG + Intergenic
930088938 2:47518013-47518035 GAGAGAGGCCACAGCATCTGAGG + Exonic
930288944 2:49468770-49468792 GAGGGAGAGCACAGTGATTGTGG - Intergenic
930439785 2:51391221-51391243 GAGGGAGAGTACAGTGACTGGGG - Intergenic
930895547 2:56441413-56441435 GAGGTAGAGCACAGTGATTGTGG - Intergenic
931012287 2:57930367-57930389 GAGGGAGCGCACAGTGATTGTGG - Intronic
931407013 2:61988946-61988968 GAGGGAGAGTGCAGCAATTGTGG - Intronic
932513092 2:72315288-72315310 GAGTGAGAACAGAGTAACTGAGG + Intronic
932517455 2:72367731-72367753 GAGGGAGAGTGCAGCAACTGGGG + Intronic
933774671 2:85764938-85764960 GAAGGAGGGAACAGCATCTGAGG + Intronic
934479118 2:94618740-94618762 GACGGGGAGCACAGCAGCTGTGG - Intergenic
935835672 2:107050631-107050653 GATGGAGAGTGCAGCCACTGGGG - Intergenic
936641540 2:114317356-114317378 GAAGGAGAGCTCAGCGACTGGGG - Intergenic
936925231 2:117730329-117730351 GAAGGAGAGCACAGCAATTATGG + Intergenic
937193958 2:120133442-120133464 GAGGGAGAGCACAGTGACTATGG + Intronic
937613671 2:123893906-123893928 GAGGGAGAGTGCAGATACTGGGG - Intergenic
938629989 2:133156051-133156073 GAGAGACAGTACAGAAACTGGGG - Intronic
938973653 2:136455461-136455483 AAGGGAGGGCTCAGCAAATGAGG - Intergenic
939273495 2:139970322-139970344 GAGGGAGAGCACAGAGACTGGGG + Intergenic
940012965 2:149073858-149073880 GAGGGAGAGGACAGCAACCTCGG + Intronic
941528353 2:166633026-166633048 AAGGGAGAGCCCAGCAATTCTGG - Intergenic
941742137 2:169046598-169046620 GAGGGAGAGCACAGTGACTGTGG + Intergenic
941746095 2:169088293-169088315 GAGGGAGAGCACAGTGATTGTGG - Intronic
941851925 2:170191633-170191655 GAGGGAGAGCACAGTGATTGGGG - Intronic
942881795 2:180870664-180870686 GAGGGAGAGTGCAGTGACTGTGG + Intergenic
943117608 2:183692443-183692465 AAGGGAGAGCACAGTGAATGGGG - Intergenic
943177103 2:184490662-184490684 GAGGGAGAGCAGAGAGATTGGGG + Intergenic
943237336 2:185338844-185338866 TAGAGAGAGCACAGTGACTGTGG - Intergenic
943500824 2:188687459-188687481 GAGGGAAAGAACAGACACTGGGG - Intergenic
943557354 2:189421787-189421809 GAGGCAGACCTCAGCAGCTGTGG + Intergenic
943913009 2:193592440-193592462 GAGGGAGAGGACCGTGACTGGGG + Intergenic
944046045 2:195413425-195413447 GAGGAAGAGCACAGCAATCGTGG + Intergenic
945672818 2:212822517-212822539 GAGGGACAGTAAAGCAACTGGGG + Intergenic
945929548 2:215841508-215841530 GAGGGAGAGGCCAGCTGCTGAGG - Intergenic
946196301 2:218034599-218034621 GAGGCAGAGCACAGCCAGGGTGG + Intergenic
947131031 2:226924808-226924830 GAGGGAGAGCACAGTGATTGTGG - Intronic
947566381 2:231196568-231196590 GAGGGAAAGCAAAGCAGGTGGGG + Intergenic
947596977 2:231419145-231419167 GAGGGAGCACACAGCAAACGAGG - Intergenic
947627799 2:231631658-231631680 GAGGGAGAGAACAGCCATAGAGG + Intergenic
947665944 2:231905298-231905320 GAGGGAGAGTCCAGCTTCTGGGG + Intergenic
948474005 2:238204709-238204731 GAGGGAGACCACATAACCTGGGG - Intergenic
948608408 2:239151369-239151391 GAGGAAGAGCACAGGGCCTGTGG - Intronic
948774554 2:240277080-240277102 GAGGGAGAGAGCAGTGACTGTGG + Intergenic
948844368 2:240676171-240676193 GAGGGAGCCCACAGCCACGGAGG - Intergenic
948849490 2:240698708-240698730 GAGGGAGCCCACAGCCACGGAGG + Intergenic
1168748202 20:263169-263191 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1169782888 20:9328124-9328146 AAGGGAGAGTACATCAAATGAGG + Intronic
1169988612 20:11474247-11474269 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1170016992 20:11792455-11792477 GAGTGAGAGCGCAACAATTGGGG - Intergenic
1170258760 20:14378344-14378366 GAGGCAGTGCCCATCAACTGAGG - Intronic
1170634749 20:18094324-18094346 GAGGGAGGGCTCAGCTACAGAGG + Intergenic
1170668265 20:18405885-18405907 GAGGGAGAGCACAGTGACTGGGG + Intronic
1171209777 20:23308391-23308413 GAAGGAGATCACTCCAACTGTGG - Intergenic
1171451589 20:25239632-25239654 AAGGATGAGCACAGCACCTGTGG - Intergenic
1172449268 20:35010310-35010332 GAGGTAAAGGACAGGAACTGGGG + Intronic
1172863615 20:38077535-38077557 GAGGCATAGCAGAGGAACTGAGG - Intronic
1173183791 20:40823821-40823843 GAGTCAGAGCATAGCACCTGGGG - Intergenic
1173199441 20:40943828-40943850 GAGGGAGGGGACATCAACAGAGG + Intergenic
1174736506 20:52971021-52971043 GTGAGAGGGCAAAGCAACTGAGG - Intergenic
1177212767 21:18091041-18091063 GAGGGAAAGCACAGCACCTGGGG + Intronic
1177760654 21:25399345-25399367 GAGGGAGAACAGAGTGACTGTGG + Intergenic
1177771194 21:25518564-25518586 GAGGGGGAGCACAGTGACTGTGG + Intergenic
1180741153 22:18054044-18054066 GAGGCAGTGCACACAAACTGTGG - Intergenic
1180835516 22:18927644-18927666 GAGGATGAACACAGCAGCTGTGG - Intronic
1181005674 22:20012367-20012389 GGGGCAGAGCAGAGCATCTGTGG + Intronic
1181281333 22:21722810-21722832 GAGTAAGAGCACAGGAAGTGAGG + Intronic
1182728271 22:32466438-32466460 TAGGTAGAGCAATGCAACTGGGG + Intergenic
1182985728 22:34714357-34714379 GTGGGAGAGGAAAGCAAGTGAGG - Intergenic
1183053074 22:35280708-35280730 CAGGCAGAGCCCATCAACTGAGG - Intronic
1183078965 22:35444225-35444247 GAGGGAGAGGAGAGGAAGTGGGG + Intergenic
1183593702 22:38796883-38796905 GAAAGAGAAGACAGCAACTGTGG - Intergenic
1183619342 22:38963617-38963639 GAGGCAGAGCCCAGCCACAGAGG + Intronic
1183624489 22:38993212-38993234 GAGGCAGAGCCCAGCCACAGAGG + Intergenic
1183640231 22:39088228-39088250 GAGGCAGAGCCCAGCCACAGAGG + Intergenic
1184421578 22:44385462-44385484 GAGGGGGAGTGCAGCCACTGTGG - Intergenic
1184727063 22:46353342-46353364 GAGGGTGCGCAGAGCAGCTGGGG + Intronic
1203285604 22_KI270734v1_random:152943-152965 GAGGATGAACACAGCAGCTGTGG - Intergenic
949829394 3:8197632-8197654 GAGGGAGAGCACAGTGACTGTGG - Intergenic
950801198 3:15552975-15552997 GAGGGAGAGTGCCGTAACTGTGG - Intergenic
951029400 3:17864125-17864147 GAGGGAGAGCACAGTGACTGTGG - Intronic
951098977 3:18664805-18664827 GTGGGGGAGGACAGAAACTGAGG - Intergenic
951129821 3:19029371-19029393 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
951260018 3:20496221-20496243 AAGGGAGAGCACAGAAACTGGGG - Intergenic
951495167 3:23317389-23317411 GACGGAGAGCACACCAACTGTGG - Intronic
951499476 3:23367966-23367988 GTGTGAGAGCAGAGGAACTGTGG + Intronic
952066560 3:29577720-29577742 GAGGGAGAATACAGCAACTGGGG - Intronic
952132931 3:30385223-30385245 GAGGGAGAGTACAGCAACTGTGG - Intergenic
952293083 3:32037172-32037194 GACAGAGAGAACAGGAACTGCGG + Intronic
952698058 3:36293545-36293567 GGAGGAGAGAGCAGCAACTGAGG - Intergenic
952725638 3:36581815-36581837 AAGGGAGAGTACAGTAATTGTGG + Intergenic
952772918 3:37018574-37018596 GGGGGAGAGCATAGAAATTGTGG + Intronic
953217187 3:40930559-40930581 GAAGGAGAGCACAGTGACTAGGG + Intergenic
953362508 3:42310280-42310302 GAGGGAGAGCACAATGACTGGGG - Intergenic
953476190 3:43207891-43207913 TGGGGAGGGGACAGCAACTGGGG - Intergenic
953929722 3:46999862-46999884 AGGCGAGAGCACAGCAAGTGAGG - Intronic
954491479 3:50910710-50910732 GAGGGAGAACAAAGTGACTGTGG - Intronic
954852616 3:53616425-53616447 GAGGGAGAGCAGAGAAAGAGGGG - Intronic
955448729 3:59043443-59043465 GAGGCAGATCAAAGCCACTGAGG + Intronic
956222770 3:66922284-66922306 GAGGGAGAGTGCAGCAGCTGGGG + Intergenic
957094331 3:75764330-75764352 GAGGTAGACCACTGCTACTGAGG - Intronic
957485588 3:80858412-80858434 GAGGGAGAGCACAGTGATTGAGG + Intergenic
957538099 3:81532021-81532043 GAGGGAAAACACAGTGACTGTGG - Intronic
957907710 3:86578953-86578975 GAGGGAGAGCACAGTGACTGGGG - Intergenic
957965723 3:87320983-87321005 GAGGGAGAGTACAGTGATTGTGG + Intergenic
959111892 3:102132516-102132538 GATGGAGTTCACAGCAGCTGTGG - Intronic
959126060 3:102291326-102291348 GAAGGAGAGCACAGTGATTGTGG - Intronic
959409151 3:105998400-105998422 GAGGGACAGCACAGCAACTCTGG - Intergenic
959716768 3:109442441-109442463 GAGGGAGACTGCAGCAATTGTGG + Intergenic
959868577 3:111300353-111300375 GAAGGAGAGCACAGTGATTGTGG - Intronic
960490640 3:118313390-118313412 GAGAGAGAGAACAGAAACTTGGG + Intergenic
960862916 3:122169501-122169523 GAGGGAGAGTGCAGCAATTATGG - Intergenic
961373300 3:126445771-126445793 GGGGGACAACTCAGCAACTGGGG - Intronic
962658015 3:137569135-137569157 CAGGGATACCACAGCAAATGAGG + Intergenic
962759242 3:138493485-138493507 GAGGGAGAGCACAGCAACTGGGG - Intergenic
962997975 3:140650719-140650741 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
963154022 3:142077042-142077064 GAGGGAGAGCTCAGTGACTGTGG + Intronic
963292160 3:143503212-143503234 CAGGGACTGCACAGCAGCTGAGG + Intronic
963443615 3:145373903-145373925 GAGGGATAGCACAGTGATTGTGG + Intergenic
963528852 3:146447986-146448008 GAGGGAGAACACAGTGATTGTGG - Intronic
964259038 3:154812392-154812414 GAGGGAGAGCACAGTGATTGTGG - Intergenic
965256983 3:166425750-166425772 GAAGGAGAGCACAGTGACAGTGG + Intergenic
965535363 3:169818170-169818192 GAGGGAGAGGAAAGTGACTGTGG - Intergenic
965844394 3:172945579-172945601 GAGGGAGAATACAGTAATTGTGG + Intronic
967697062 3:192544178-192544200 GAGGGAGAGCACAGTGATTGTGG - Intronic
968017907 3:195356192-195356214 GGGAAAGAGCACAGCAACTGTGG + Intronic
968813241 4:2809343-2809365 GAGGGAGGGCACTGAACCTGGGG - Intronic
968964736 4:3764162-3764184 GATGGTGAGCACCTCAACTGAGG + Intergenic
969330044 4:6469359-6469381 GAGGTAGATCAGAGCAGCTGGGG + Intronic
970442355 4:16092788-16092810 GAGAGAGAGCACAGTGGCTGGGG + Intergenic
970794890 4:19899542-19899564 GAGGCAGAGAACAGAAACTTAGG + Intergenic
972271201 4:37512036-37512058 GAGGGAGAGCACAGTGATTGTGG - Intronic
973169469 4:47121266-47121288 GAAGAAAAGCACAGCAATTGTGG - Intronic
973227406 4:47802002-47802024 AAGGGAGAGCACAGCAACTGGGG + Intronic
973287946 4:48440429-48440451 GAGGGAGAGCACAGTGACTGTGG - Intergenic
973763205 4:54139671-54139693 GAGGGAGAGCACAGCAACCGGGG + Intronic
974193292 4:58536099-58536121 AAGGGACAGTACAGCAACTGAGG - Intergenic
975295138 4:72726122-72726144 GAGGGAGAGCACAGTGATTGTGG + Intergenic
975314343 4:72933900-72933922 GAAGGAGAGCACAGCGATTGTGG - Intergenic
975409520 4:74033064-74033086 CAGGGAGAGGAGAGCAAGTGAGG + Intergenic
975466472 4:74714861-74714883 GAGGGAGGGCAATGCATCTGTGG - Intergenic
975629560 4:76386776-76386798 CAGGGAGAGCACAGCAACTGGGG + Intronic
976030148 4:80741996-80742018 GATGGAGAGCACAGCAAATGGGG - Intronic
976523469 4:86058329-86058351 AAGGGGGAGGACAGCATCTGTGG - Intronic
976701641 4:87975725-87975747 GAGGCAGAGCACAGCATCGTCGG + Exonic
976721950 4:88177768-88177790 GAGGGAGAGCACAGCGATTATGG + Intronic
977381121 4:96274852-96274874 GAGAGAGACCACAGCAACTGTGG - Intergenic
977521739 4:98093744-98093766 GAGGCAAAGCACAGCAATTGGGG + Intronic
978654251 4:111048210-111048232 GAGGGAGAGCACAGTGATTGTGG + Intergenic
979213392 4:118133373-118133395 GAGGGAGAGCACAGTGACAGGGG - Intronic
980172526 4:129306618-129306640 GAGGGAGAGCACAGTGACTGGGG - Intergenic
980752911 4:137115751-137115773 GAGGGAGAGCACAATGACTGTGG + Intergenic
981140121 4:141258676-141258698 GAGGGAGAACACAGTGATTGTGG + Intergenic
981530911 4:145752946-145752968 GAGTGAGAGCACAGCGATTGTGG - Intronic
981996045 4:150976808-150976830 GTGGGAGAGTGCAGCGACTGTGG + Intronic
982126834 4:152191018-152191040 GAGGGACAAGACCGCAACTGTGG + Intergenic
982828404 4:160028276-160028298 GAGGGAGAGCACAGAACTGGAGG - Intergenic
982899627 4:160981602-160981624 GAGGCAGAGCACAGAGACTGGGG - Intergenic
982905359 4:161062006-161062028 GAGAGAGAGCACAGCACATTGGG + Intergenic
983130357 4:164011908-164011930 GAGGGAGAGCAAAGTGAGTGTGG + Intronic
983269924 4:165549391-165549413 GAAGGAGAGGAGAGCACCTGTGG - Intergenic
983338183 4:166422025-166422047 GAGGGAGAGCACAGTGACTGTGG - Intergenic
983417626 4:167479368-167479390 GAGGGAGAGCAAAGTGACTGTGG + Intergenic
984529877 4:180902738-180902760 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
985384858 4:189434625-189434647 GAGGGAGAGCACAGTAACTGGGG - Intergenic
985653671 5:1119054-1119076 GAGGGTGAGCACACCAGATGCGG - Intergenic
985942592 5:3150603-3150625 GAGGGAGAGGAGAGGAGCTGTGG + Intergenic
985943848 5:3161872-3161894 GAGGGAGATCTCAGCACCTGTGG + Intergenic
986576891 5:9221896-9221918 AGGGGAGAGGACAGGAACTGGGG + Intronic
987209804 5:15669382-15669404 GGGTCAGAGCACAGCAACTGGGG - Intronic
988265428 5:28942667-28942689 GTGGGAGAGCACAGTTATTGTGG - Intergenic
989657816 5:43762871-43762893 GAGGGAAAGCACAGTTACTGTGG - Intergenic
989672497 5:43935504-43935526 GAGGGAAAGAACAGCAATTGTGG + Intergenic
990548652 5:56850173-56850195 GAGGAAGAGGACAGCAAGGGAGG - Intronic
990827816 5:59922043-59922065 GAGGGAGAGTGCAGCGACTGGGG + Intronic
991209250 5:64085213-64085235 GAGGGAGAGTGCAGTGACTGTGG - Intergenic
991212108 5:64117830-64117852 GAGGGAGTGCAAAGACACTGAGG - Intergenic
991298681 5:65106441-65106463 GAGAGAGAGCACTGCCCCTGAGG - Intergenic
991395411 5:66199281-66199303 GAGGGAGAGTACAGCAATTGTGG - Intergenic
992257262 5:74933440-74933462 TAGGGAGAGCACAGGAAATCGGG + Intergenic
992794534 5:80243914-80243936 GTGGGGGAGCACAGAAAGTGGGG + Intronic
992827722 5:80567386-80567408 GAGGGGGAGCGGATCAACTGAGG + Intronic
992934417 5:81687190-81687212 GAGGGAGAGCACAGTGACTGTGG + Intronic
993932316 5:93954958-93954980 GAGGGAGAGCACAGTGACTGTGG - Intronic
993981134 5:94545037-94545059 GAGGGAGAGCACAGTGACTGGGG + Intronic
994343678 5:98661422-98661444 GAGGGAGAACACAGCAACTGGGG + Intergenic
995185440 5:109266740-109266762 GAGAGAGATTACAGCATCTGGGG + Intergenic
995265184 5:110151838-110151860 GAGGCAGAGCACAGTGACTGGGG + Intergenic
995290373 5:110444375-110444397 GAGGGAGAGCTCAGTGACTGGGG - Intronic
995374989 5:111463789-111463811 GGGGGAGAGCACAGCATCAAGGG + Intronic
995557425 5:113344122-113344144 GAGGGAAAGCACAGCAAGTGGGG + Intronic
995836345 5:116403259-116403281 GAGTGAAAGCACAGCAATGGTGG - Intronic
996116368 5:119624465-119624487 GAGTGAGAGAAAAGCAAATGTGG - Intronic
996166513 5:120229827-120229849 GAGGGAGAGTGCAGTGACTGGGG - Intergenic
996192669 5:120564563-120564585 AAGAGAGAGCACAGTGACTGGGG - Intronic
996459423 5:123724727-123724749 GAGGGAGAGTGCAGCGACCGGGG + Intergenic
996693815 5:126370447-126370469 GAGAGAGAGCATAGCTACTGTGG + Intronic
996708545 5:126521437-126521459 GATTTAGAGCACAGCAGCTGGGG + Intergenic
996956294 5:129187102-129187124 GAGGGAGAGTTCAGCAGTTGTGG + Intergenic
997142433 5:131397064-131397086 GCGGGAGAGCACAGCAGCAGCGG - Intronic
997577616 5:134994731-134994753 GAGAGAGAGCAGAGCAGCAGAGG - Intronic
997607502 5:135185638-135185660 CAGGCAGAGCCCAGCAGCTGTGG + Intronic
998291304 5:140917085-140917107 GAAGTAAAGCACAGCAACTGGGG - Intronic
998394425 5:141809488-141809510 GAAGGAGAGCACAGCTAAGGTGG + Intergenic
999114198 5:149148283-149148305 TAGGTAGAGCACAGCAGGTGGGG + Intronic
999195213 5:149777332-149777354 GACAGAGAGCTCAGCAACCGTGG - Intronic
999279508 5:150355747-150355769 GAGGGAGAGCAGGGGGACTGGGG - Intergenic
1001200421 5:169711054-169711076 CAGGCAGAGCAAAGGAACTGAGG - Intronic
1001845254 5:174916444-174916466 GAGGGAGAATGCAGCAACTGTGG + Intergenic
1002081661 5:176741086-176741108 CAGGGAGAGCACAGCGGCTGTGG + Intergenic
1002094856 5:176824741-176824763 CAGGGAGTGCACAGGCACTGGGG - Intronic
1003950531 6:11111536-11111558 CAGGGGGAGCAGAGCCACTGTGG + Intronic
1004170002 6:13288434-13288456 GTGAGAGAGCTCTGCAACTGAGG - Exonic
1004627802 6:17393527-17393549 GAGGGAGAGCAAAGCCACGCGGG - Exonic
1006244372 6:32717517-32717539 GAGAGAGAGCACATCAGCAGAGG - Intergenic
1007271690 6:40642271-40642293 GGGGGAGCGGACAGCATCTGAGG + Intergenic
1007626279 6:43247947-43247969 GAGGGAGAGTACAGAAATCGGGG + Intronic
1007972576 6:46067599-46067621 GAGGATTTGCACAGCAACTGGGG - Intronic
1008101148 6:47392496-47392518 GAGGGAGACAACAGTGACTGTGG - Intergenic
1008185803 6:48388962-48388984 GAGGGAGAGCACCGCATCAAGGG - Intergenic
1008707662 6:54182319-54182341 AAGGAAGAGCACAGCAACTGGGG - Intronic
1009664318 6:66655579-66655601 GAAGTTGAGCACAGCAGCTGTGG + Intergenic
1009728138 6:67560548-67560570 GAGGGAGAGCAAAGTGATTGTGG - Intergenic
1009748207 6:67847707-67847729 GAGGGAGAGCGCAGTGACTGGGG + Intergenic
1009823749 6:68839900-68839922 GAGGGAGAGCACAGTGATTGTGG + Intronic
1010062273 6:71636479-71636501 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1010855100 6:80828265-80828287 GAGGGAAACCACAGACACTGGGG - Intergenic
1011102966 6:83744387-83744409 GAGGGAGAGGGCAGCAATGGGGG - Intergenic
1011136432 6:84105644-84105666 GAGGTAGAGAACAGTAACTCTGG - Intergenic
1011291282 6:85779803-85779825 GACAGAGAGCACAGCAACTGTGG - Intergenic
1011359815 6:86511372-86511394 GAGGGGGAGAACAGTAATTGTGG - Intergenic
1011791966 6:90908027-90908049 GAAAAAGAGCACAGCAACTGAGG - Intergenic
1012783125 6:103589063-103589085 GAGGGAAAGCGCAGCAATAGTGG - Intergenic
1013247291 6:108298914-108298936 GAAGGAGAGCAGGGCAGCTGAGG + Intronic
1013298177 6:108778650-108778672 GATTCAGAGCACAGCAGCTGGGG + Intergenic
1013344993 6:109251410-109251432 GAGAGAGAGTACAGAAAGTGGGG - Intergenic
1013466221 6:110419195-110419217 CATGGAGAGCACAGCAAGAGGGG - Intergenic
1013908449 6:115245935-115245957 GAGGAAGAGTACAGCGATTGTGG + Intergenic
1014275610 6:119384877-119384899 GAGGAAGAGTGCAGCGACTGCGG - Intergenic
1014430535 6:121365378-121365400 TGGAGAGAGCACAGCAATTGTGG + Intergenic
1014673069 6:124330802-124330824 GAGGCAGAGCTCAGGAACTCAGG - Intronic
1014794605 6:125710323-125710345 GAGGGAGAACGCAGGAATTGTGG + Intergenic
1014840903 6:126219008-126219030 GAGGGAAAGCATAACAATTGTGG - Intergenic
1016229683 6:141788278-141788300 GAGGGAGAGCATAGTAATTGTGG + Intergenic
1016249884 6:142028143-142028165 GAGGGAAACAACAGAAACTGGGG + Intergenic
1016457464 6:144245763-144245785 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1016583813 6:145661044-145661066 GAGACAGGGCACAGCAACAGAGG + Intronic
1017924848 6:158901827-158901849 AAGGGAGAGCACAGCAACTAGGG - Intronic
1019319396 7:408778-408800 CAGGCAGAGGACAGCACCTGTGG + Intergenic
1020422641 7:8026617-8026639 GAAGAAGAGCACAGCGACTGGGG + Intronic
1020624194 7:10557900-10557922 AAGGGAAAGCACAGCAACTGGGG + Intergenic
1021214741 7:17901610-17901632 GAGGGAGAGCACAGTGATTATGG - Intronic
1021513294 7:21456913-21456935 GAGGGGGAGCAGAGCCACTGTGG + Intronic
1021640863 7:22735054-22735076 GAAGGAGAACACATCAATTGTGG + Intergenic
1021842546 7:24732627-24732649 GAGGGAGAGCACAGCAACTGTGG + Intronic
1022542095 7:31146834-31146856 AAGGGAGAGCACAGTGATTGTGG - Intergenic
1023085261 7:36564030-36564052 GAGGCAGATCACAGCTACTGTGG - Intronic
1023728342 7:43166885-43166907 CCTGGAGAGCTCAGCAACTGTGG + Intronic
1024104341 7:46067014-46067036 GAGGGAGAGGAGAGGAACAGAGG - Intergenic
1024369223 7:48560324-48560346 GAGGAAGAGCACAGTGACTGGGG - Intronic
1026275569 7:68872777-68872799 GAAGTAGAGCACAGCAAGCGAGG - Intergenic
1028207663 7:88034820-88034842 AAGGGAGAGCACAGCAATTGTGG - Intronic
1029662427 7:101971690-101971712 GAGGGAAAGCACAGCTCCTCTGG + Intronic
1030080145 7:105770582-105770604 GAGGGACAGCAGAGGAAATGGGG + Intronic
1030662619 7:112238246-112238268 GAGGGAGAGCGCAGTAATTGTGG + Intronic
1031098366 7:117448191-117448213 AGGGAAGAGCACAGCAAATGGGG + Intergenic
1031215327 7:118883094-118883116 GAGGGAGAGCACAGTGATCGGGG + Intergenic
1031243858 7:119281648-119281670 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1031721808 7:125186644-125186666 GAGAGAGAGCACAGTGATTGTGG + Intergenic
1031862197 7:126993673-126993695 GAGGGAGAGCACAGTGACTGGGG + Intronic
1031899103 7:127391458-127391480 GATGGAGGGCAAAGCAACTGCGG + Intronic
1032392050 7:131561621-131561643 GAAGGTGAGCACAGCATTTGGGG + Intergenic
1032490182 7:132318511-132318533 GAGGGAGAGTCCTGCAGCTGAGG - Intronic
1032939027 7:136767576-136767598 AAGAGAGAGCACAGCAACTGGGG + Intergenic
1033842969 7:145397357-145397379 GACAGACAGCACAGCAGCTGTGG - Intergenic
1033866633 7:145697582-145697604 GAAGTCGAGCACAGCAGCTGCGG + Intergenic
1034126285 7:148674825-148674847 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1035017949 7:155782642-155782664 GGGGGAGAGCACAGTGGCTGTGG + Intergenic
1035138979 7:156738174-156738196 GAGGGAGAGCACAACAAATGGGG + Intronic
1035231388 7:157468100-157468122 GGGGGACAGAACAGAAACTGGGG + Intergenic
1035961941 8:4147362-4147384 GGAGGAGAGCACAGCCACTGAGG - Intronic
1036814935 8:11895016-11895038 GAAGGAGAGCACAGCAATCGCGG - Intergenic
1037225988 8:16590663-16590685 GAGGGAAACCACAGACACTGGGG + Intergenic
1037254739 8:16941133-16941155 GAGGGAGAGCACAGTGACTAGGG + Intergenic
1037748861 8:21667068-21667090 GAGGGTGAGCAGAGCAGCTCGGG + Intergenic
1038516220 8:28189805-28189827 GAGGCTGAGCAGAGCAAATGGGG + Exonic
1038863040 8:31408578-31408600 CAGGAACTGCACAGCAACTGTGG - Intergenic
1039064623 8:33598050-33598072 CAGGGAGACAACAGCAGCTGAGG + Intronic
1039215980 8:35272059-35272081 CCGGGAGAACACAGCAGCTGTGG + Intronic
1040049770 8:43001917-43001939 AAGGGAGAGCACAGCCCCTAAGG - Intronic
1040329949 8:46380809-46380831 GAGGGAGATCACAGGGACTCAGG + Intergenic
1040721104 8:50324271-50324293 GAGGAAGAGCACAGCAACTGAGG - Intronic
1040811599 8:51460548-51460570 GAGGGGAAACACAGCCACTGAGG + Intronic
1041464181 8:58142527-58142549 GTGGGGGAGCACATCATCTGTGG - Intronic
1041580014 8:59447674-59447696 GAGGGAGAGCACAGCAACTGGGG - Intergenic
1041582961 8:59483846-59483868 GAGAGAGAGCATAGCAACTGGGG - Intergenic
1041786910 8:61644994-61645016 GAGCGAAAGTACAGCAACTATGG + Intronic
1043600225 8:81928617-81928639 GAGGGAGAGTGCAGCAACTGGGG + Intergenic
1044124164 8:88437341-88437363 GAGGGAGAGCCCAGCGATTCTGG + Intergenic
1045420575 8:102010663-102010685 GTGGGAAAGAACAGCAACTTTGG + Intronic
1045592600 8:103614342-103614364 AAGGGAGAGCATAGTGACTGGGG - Intronic
1045621116 8:103979777-103979799 GAGGAAGAGCGCAGTGACTGGGG + Intronic
1046036730 8:108851887-108851909 GGAGGAGAGCAGAGCCACTGTGG - Intergenic
1046811543 8:118538559-118538581 GAGGGAGAGCACAGTGATTGTGG - Intronic
1047092993 8:121594181-121594203 GAGCAAGAGCACAGCATCAGAGG + Intergenic
1047841080 8:128754147-128754169 GAAGGAGAGCATATGAACTGGGG + Intergenic
1048072817 8:131040020-131040042 GAGCGAGCGCACAGCACCTGCGG - Exonic
1048118672 8:131554818-131554840 GAGGGAGAGCACAGTGACTGTGG + Intergenic
1050145097 9:2559368-2559390 GAGGGAGAGCACAGTAATTTAGG + Intergenic
1050151183 9:2621421-2621443 TAGGGAGCGCACAGCCGCTGCGG + Intergenic
1050293887 9:4184806-4184828 GAGGGAGTGAAAAGGAACTGAGG + Intronic
1050644411 9:7703296-7703318 GAGGGAGAATACAGTCACTGAGG - Intergenic
1050907013 9:11016894-11016916 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1051306617 9:15717180-15717202 AAGGGAGAGCACAGTGATTGTGG + Intronic
1051455186 9:17247433-17247455 GAGGCAGAGCACAGGGACTGTGG - Intronic
1052093880 9:24361732-24361754 GAGGGAGAGCACAGTGATTGTGG + Intergenic
1052258901 9:26491794-26491816 GAGGGAGAACACAGCAGTTGTGG - Intergenic
1052450603 9:28625285-28625307 GAGGGAGAACACAGTGACTTAGG - Intronic
1052500254 9:29280117-29280139 GAGGGATAGTCCAGCCACTGTGG + Intergenic
1053110089 9:35452593-35452615 GAGGGAGAGCACAGCAATTGTGG + Intergenic
1053678709 9:40464825-40464847 GACCGGGAGCACAGCAGCTGTGG + Intergenic
1053928694 9:43093178-43093200 GACCGGGAGCACAGCAGCTGTGG + Intergenic
1054285014 9:63160117-63160139 GACCGGGAGCACAGCAGCTGTGG - Intergenic
1054291787 9:63300363-63300385 GACCGGGAGCACAGCAGCTGTGG + Intergenic
1054389805 9:64604906-64604928 GACCGGGAGCACAGCAGCTGTGG + Intergenic
1054505909 9:65911470-65911492 GACCGGGAGCACAGCAGCTGTGG - Intergenic
1055473960 9:76643023-76643045 GACGGAGAGCACAGCAAACCAGG + Intronic
1056230694 9:84539729-84539751 GAGGGAGAACACAGTGATTGTGG - Intergenic
1057570576 9:96201387-96201409 GAGGGAGCGCAGGGCAACTCGGG - Intergenic
1057624869 9:96668058-96668080 CAGGTAGAGCACAGGAACAGTGG + Intergenic
1057644315 9:96858873-96858895 GAGGGAGAGCACAGCAGCTGTGG + Intronic
1058285364 9:103170066-103170088 GAGGGAGAGGGCAGTGACTGTGG - Intergenic
1058897556 9:109413406-109413428 GAGGAAGAGGACATCAAATGAGG + Intronic
1059243757 9:112831816-112831838 CAGCGAGAGCACAGCACCTCAGG - Intronic
1059287340 9:113186195-113186217 GAGGGAAAGCACAGCAAGAGCGG + Intronic
1059886565 9:118751079-118751101 GAGGGACAGCACAGTGATTGTGG + Intergenic
1060240361 9:121897800-121897822 GAGGGAAAACACAGCAGCAGAGG - Intronic
1060328586 9:122643302-122643324 GAGGGAGAGCACAGCAACTGAGG + Intergenic
1060767740 9:126307714-126307736 GACGGTGAGGACAGCAGCTGAGG + Intergenic
1061097819 9:128470098-128470120 AAGAGAGAGCACGGCAACTGAGG - Intronic
1061164886 9:128916519-128916541 GAGCGAGAGGACAGTATCTGTGG + Exonic
1061638141 9:131928556-131928578 GAGGGAGAGCACAGCGACTGGGG + Intronic
1061744024 9:132726703-132726725 GTGGGACATTACAGCAACTGTGG + Intronic
1061788675 9:133046622-133046644 CACGGACAGCACAGCAGCTGGGG + Intronic
1062135106 9:134922662-134922684 GAGGGAGAGGCCAGCCAGTGAGG + Intergenic
1062181219 9:135192243-135192265 TAGTGGGAGCACAGCAGCTGAGG - Intergenic
1186602035 X:11048607-11048629 GAGGGAGAGCACAGTGTCTGGGG - Intergenic
1186605574 X:11086546-11086568 GAGAGAGAACAAAGCAAATGTGG - Intergenic
1186925876 X:14332942-14332964 GATGGAGGGCACAGCAAGGGTGG - Intergenic
1187082104 X:16001488-16001510 GGGGAAGAGCACAGCATCAGTGG - Intergenic
1187575126 X:20545996-20546018 GAGGGACAGCACAGCAATTGTGG - Intergenic
1187636676 X:21237416-21237438 GAGGGAGAACATAGTGACTGTGG + Intergenic
1188053504 X:25514536-25514558 GAGGGAGAGCAAAAAAGCTGTGG + Intergenic
1188421226 X:29992519-29992541 GAGGGAGGGCATAGTAATTGTGG - Intergenic
1188625198 X:32276064-32276086 AAGGGACAGTACAGCTACTGGGG + Intronic
1188715520 X:33455710-33455732 GAGGGAGAGTGCAGCAATTCTGG + Intergenic
1188972405 X:36633563-36633585 GAGGGAGAGCACAGTGATTATGG - Intergenic
1188973267 X:36642556-36642578 GAGGAAAAGCAAAGCAACTGTGG - Intergenic
1188974774 X:36659977-36659999 AAAGGAGAGCACAGAGACTGGGG + Intergenic
1189405608 X:40720354-40720376 GAGGGAGAGAATAGTGACTGGGG + Intronic
1189628050 X:42920736-42920758 GAGGGAGAGCACAGTGATCGTGG + Intergenic
1190301905 X:49062018-49062040 GAGTGAGAGCACAGCAAGTGGGG - Exonic
1190374468 X:49775452-49775474 GAGGGAGAGTGCAGCAACTGGGG - Intergenic
1190517067 X:51234822-51234844 GAGGGAGACCACAGAAGCAGAGG + Intergenic
1190537134 X:51440587-51440609 GAGGGACAGCACAGCAACTGGGG + Intergenic
1191194229 X:57704205-57704227 GAGGGAGAGTAAGGCTACTGTGG - Intergenic
1191700566 X:64037745-64037767 GAAGGAGAGCACAGCAACAGAGG + Intergenic
1191990958 X:67036598-67036620 GAGGGAGAGCACAATGACTGGGG - Intergenic
1192374755 X:70548602-70548624 AAGGGAGAGCACAGTGATTGTGG + Intronic
1192400122 X:70826602-70826624 GAGGAAGAGCACAGCAGCTGGGG + Intronic
1192731957 X:73809443-73809465 GATGGAGAGTGAAGCAACTGGGG - Intergenic
1192890814 X:75389051-75389073 GAGGGAGAGTGCAGTGACTGTGG + Intronic
1193052536 X:77116266-77116288 GAGGGAGAGTGCAGCAATTGTGG - Intergenic
1193246918 X:79239789-79239811 GAGGGAGAGTGCAGCAACTAGGG - Intergenic
1193267412 X:79488581-79488603 GAGGGAGACAACAGATACTGGGG - Intergenic
1193650157 X:84122234-84122256 GAGGGAAAGCTCAGCAACTGGGG + Intronic
1193802348 X:85951911-85951933 GAGTGAGAGCATAGCAACTGGGG + Intronic
1193857050 X:86615947-86615969 GAGGGAGACAACAGACACTGTGG - Intronic
1193912138 X:87318259-87318281 GAGCGAAAGAACAGCAATTGTGG - Intergenic
1193933197 X:87582385-87582407 TAGGGATAACACAGCAATTGTGG + Intronic
1194095646 X:89636023-89636045 GAGGGACAGCACAGCAATTGTGG + Intergenic
1194251819 X:91585353-91585375 GAGGGAGAGTGCAGAAATTGTGG + Intergenic
1194327793 X:92541353-92541375 GAGGGAGAGCACAGTGACCTAGG - Intronic
1194338703 X:92682288-92682310 AAGGGATAGCACACCAAGTGAGG - Intergenic
1194415378 X:93605733-93605755 GAGGCAGAGCACAGTGAATGGGG + Intergenic
1194842078 X:98754822-98754844 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1194877653 X:99209002-99209024 GAGGGAGAGTACCGCAATTGTGG - Intergenic
1194937741 X:99971125-99971147 GAGGGAGAGCACAATTATTGTGG - Intergenic
1194942782 X:100032426-100032448 GAGGGAAAGAACAGACACTGGGG + Intergenic
1195199243 X:102532132-102532154 TAGGAAGAGTGCAGCAACTGGGG + Intergenic
1195290156 X:103424429-103424451 GAGGGAGAGCACAGTGATTGTGG - Intergenic
1195543436 X:106088250-106088272 GAAGGAAAGCACAGCAATTGTGG - Intergenic
1195601224 X:106751276-106751298 GAAGGAGAGCACAGTGATTGTGG + Intronic
1196215745 X:113050048-113050070 GAGGGAGAATGCAGCAATTGTGG + Intergenic
1196217703 X:113072669-113072691 GAGGGAGAGCTCAGTGATTGTGG - Intergenic
1196270184 X:113700452-113700474 GAGGGAGAGTGTAGCATCTGGGG - Intergenic
1196368741 X:114951973-114951995 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
1196384962 X:115139689-115139711 GAGGGAGAGCACAGGGACTGGGG + Intronic
1196485705 X:116204164-116204186 GAGGGAGAGTGCAGCAACTGGGG - Intergenic
1196510218 X:116500281-116500303 AAGAGAGAGCACTGCAACTGGGG - Intergenic
1196532643 X:116806794-116806816 GAGAGACAGCACAGTGACTGGGG - Intergenic
1197072825 X:122321354-122321376 GAAGGAGAGCACAGCAACTGGGG + Intergenic
1197099677 X:122637408-122637430 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1197177964 X:123504779-123504801 GAGGGAGAGCACAGTGATTTGGG + Intergenic
1197435762 X:126425960-126425982 GAGGGAGAAAACAGCAATTATGG - Intergenic
1197457902 X:126700978-126701000 AAGGGAGAGCACAGTGACTGGGG + Intergenic
1197623651 X:128779836-128779858 GAGGGAGAGCACAGTGACTGGGG - Intergenic
1197670703 X:129273799-129273821 GAGGGAAAGCACAGTGATTGTGG - Intergenic
1197953033 X:131918399-131918421 AAGGGAGAGTGCAGCAACTGTGG + Intergenic
1198278063 X:135116201-135116223 GAGGGAGAGTGCAGCAAGTGGGG - Intergenic
1198292899 X:135256315-135256337 GAGGGAGAGTGCAGCAAGTGGGG + Intronic
1198724786 X:139665475-139665497 GAGGGAGATCACAGAAACTGTGG - Intronic
1198761560 X:140038344-140038366 GAGGGAGAGGAAAGTGACTGTGG + Intergenic
1199018668 X:142848909-142848931 GACAGAGCACACAGCAACTGGGG - Intergenic
1199138998 X:144287958-144287980 GAGGGAGAGCACAGCAAGTGAGG - Intergenic
1199188945 X:144948842-144948864 GAGGGAGAGCAAAGTGAGTGTGG + Intergenic
1199223045 X:145339713-145339735 GAGGGAGAGTGCAACAATTGTGG + Intergenic
1199325090 X:146489932-146489954 GAGGGAGAGTACAGTGACTGAGG + Intergenic
1199457510 X:148045031-148045053 GAGGGAGAGCACAGTGGTTGTGG - Intergenic
1199464452 X:148120314-148120336 GAGGGAGAGCAAAGTGATTGTGG + Intergenic
1199484973 X:148337733-148337755 GAGGGAGAGCACAGAGACTGGGG + Intergenic
1199711150 X:150470548-150470570 GAGGCAGACCAGACCAACTGGGG - Exonic
1199795395 X:151191063-151191085 GAGGGAGAGCAAAGTGATTGCGG + Intergenic
1200177206 X:154125532-154125554 GAGGGAGGGCACGGTGACTGTGG + Intergenic
1200370090 X:155715868-155715890 GAGGGCAAGCACAGCGACTGGGG - Intergenic
1200448645 Y:3297391-3297413 GAGGGACAGCACAGCAATTGTGG + Intergenic
1200570753 Y:4826584-4826606 GAGGGAGAGTGCAGAAATTGTGG + Intergenic
1200636507 Y:5660571-5660593 GAGGGAGAGCACAGTGACCTAGG - Intronic
1200883096 Y:8241081-8241103 GAAGGAGAGCACAAGGACTGAGG - Intergenic
1200883571 Y:8245727-8245749 GAAGGAGAGCACAAGGACTGAGG - Intergenic
1201060952 Y:10046386-10046408 GAAGGAGAGCACAAGGACTGAGG - Intergenic
1201981889 Y:19917588-19917610 GATGGAGAGCACAGGAAAAGTGG - Intergenic
1202111134 Y:21421821-21421843 GAAGGAGAGCACAGAGACTGAGG - Intergenic