ID: 1066708133

View in Genome Browser
Species Human (GRCh38)
Location 10:38203221-38203243
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066708120_1066708133 22 Left 1066708120 10:38203176-38203198 CCAGCTGTGGACCTGTGGTGAGG No data
Right 1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG No data
1066708119_1066708133 23 Left 1066708119 10:38203175-38203197 CCCAGCTGTGGACCTGTGGTGAG No data
Right 1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG No data
1066708117_1066708133 29 Left 1066708117 10:38203169-38203191 CCATGTCCCAGCTGTGGACCTGT No data
Right 1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG No data
1066708125_1066708133 11 Left 1066708125 10:38203187-38203209 CCTGTGGTGAGGAGAGGGGCTAC No data
Right 1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG No data
1066708116_1066708133 30 Left 1066708116 10:38203168-38203190 CCCATGTCCCAGCTGTGGACCTG No data
Right 1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066708133 Original CRISPR AGGGAGAGCACAGCAACTGT GGG Intergenic