ID: 1066710004

View in Genome Browser
Species Human (GRCh38)
Location 10:38223285-38223307
Sequence GGTAACACCCTCTCATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066709997_1066710004 26 Left 1066709997 10:38223236-38223258 CCTTTCCTTCCAAAACCTATTTT No data
Right 1066710004 10:38223285-38223307 GGTAACACCCTCTCATCTAATGG No data
1066709998_1066710004 21 Left 1066709998 10:38223241-38223263 CCTTCCAAAACCTATTTTCTCTG No data
Right 1066710004 10:38223285-38223307 GGTAACACCCTCTCATCTAATGG No data
1066710000_1066710004 17 Left 1066710000 10:38223245-38223267 CCAAAACCTATTTTCTCTGGCAT No data
Right 1066710004 10:38223285-38223307 GGTAACACCCTCTCATCTAATGG No data
1066710001_1066710004 11 Left 1066710001 10:38223251-38223273 CCTATTTTCTCTGGCATTGATGC No data
Right 1066710004 10:38223285-38223307 GGTAACACCCTCTCATCTAATGG No data
1066709996_1066710004 27 Left 1066709996 10:38223235-38223257 CCCTTTCCTTCCAAAACCTATTT No data
Right 1066710004 10:38223285-38223307 GGTAACACCCTCTCATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066710004 Original CRISPR GGTAACACCCTCTCATCTAA TGG Intergenic
No off target data available for this crispr