ID: 1066710824

View in Genome Browser
Species Human (GRCh38)
Location 10:38231460-38231482
Sequence CTGTATGAGGTGGTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066710824_1066710832 21 Left 1066710824 10:38231460-38231482 CCTTCCTGCACCACCTCATACAG No data
Right 1066710832 10:38231504-38231526 GCTCATGGCTCCTCATGCCATGG No data
1066710824_1066710831 6 Left 1066710824 10:38231460-38231482 CCTTCCTGCACCACCTCATACAG No data
Right 1066710831 10:38231489-38231511 CTGAGAGACTTTACTGCTCATGG No data
1066710824_1066710833 28 Left 1066710824 10:38231460-38231482 CCTTCCTGCACCACCTCATACAG No data
Right 1066710833 10:38231511-38231533 GCTCCTCATGCCATGGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066710824 Original CRISPR CTGTATGAGGTGGTGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr