ID: 1066711005

View in Genome Browser
Species Human (GRCh38)
Location 10:38233753-38233775
Sequence GTGTGGGTCTGGCCCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066711001_1066711005 -1 Left 1066711001 10:38233731-38233753 CCATGGCAAGGAAGCTCACTCAG No data
Right 1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG No data
1066710999_1066711005 13 Left 1066710999 10:38233717-38233739 CCTGCTTTTCTGTGCCATGGCAA No data
Right 1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066711005 Original CRISPR GTGTGGGTCTGGCCCTCAGC AGG Intergenic
No off target data available for this crispr