ID: 1066714036

View in Genome Browser
Species Human (GRCh38)
Location 10:38267038-38267060
Sequence TATTATGCACAGGGCACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066714031_1066714036 1 Left 1066714031 10:38267014-38267036 CCCCTAGTTTTAATTTATTAAGA No data
Right 1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG No data
1066714032_1066714036 0 Left 1066714032 10:38267015-38267037 CCCTAGTTTTAATTTATTAAGAA No data
Right 1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG No data
1066714033_1066714036 -1 Left 1066714033 10:38267016-38267038 CCTAGTTTTAATTTATTAAGAAT No data
Right 1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG No data
1066714030_1066714036 2 Left 1066714030 10:38267013-38267035 CCCCCTAGTTTTAATTTATTAAG No data
Right 1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066714036 Original CRISPR TATTATGCACAGGGCACTCT AGG Intergenic
No off target data available for this crispr