ID: 1066716293

View in Genome Browser
Species Human (GRCh38)
Location 10:38289834-38289856
Sequence GTGTGGGAGGGGAGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066716293_1066716305 22 Left 1066716293 10:38289834-38289856 CCTTCCATCCTCCCCTCCCACAC No data
Right 1066716305 10:38289879-38289901 CGAGTGCAGAAGAGAATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066716293 Original CRISPR GTGTGGGAGGGGAGGATGGA AGG (reversed) Intergenic
No off target data available for this crispr