ID: 1066716612

View in Genome Browser
Species Human (GRCh38)
Location 10:38293470-38293492
Sequence CCTGCCCCAGGGTCACCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066716612_1066716618 6 Left 1066716612 10:38293470-38293492 CCAGTTGGTGACCCTGGGGCAGG No data
Right 1066716618 10:38293499-38293521 GAACTCACAGCAATCAGGAGTGG No data
1066716612_1066716622 24 Left 1066716612 10:38293470-38293492 CCAGTTGGTGACCCTGGGGCAGG No data
Right 1066716622 10:38293517-38293539 AGTGGGATTACTTTACACTGGGG No data
1066716612_1066716620 22 Left 1066716612 10:38293470-38293492 CCAGTTGGTGACCCTGGGGCAGG No data
Right 1066716620 10:38293515-38293537 GGAGTGGGATTACTTTACACTGG No data
1066716612_1066716619 7 Left 1066716612 10:38293470-38293492 CCAGTTGGTGACCCTGGGGCAGG No data
Right 1066716619 10:38293500-38293522 AACTCACAGCAATCAGGAGTGGG No data
1066716612_1066716621 23 Left 1066716612 10:38293470-38293492 CCAGTTGGTGACCCTGGGGCAGG No data
Right 1066716621 10:38293516-38293538 GAGTGGGATTACTTTACACTGGG No data
1066716612_1066716617 1 Left 1066716612 10:38293470-38293492 CCAGTTGGTGACCCTGGGGCAGG No data
Right 1066716617 10:38293494-38293516 CGCTGGAACTCACAGCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066716612 Original CRISPR CCTGCCCCAGGGTCACCAAC TGG (reversed) Intergenic
No off target data available for this crispr