ID: 1066716757

View in Genome Browser
Species Human (GRCh38)
Location 10:38295028-38295050
Sequence TTATTTCCAAACAAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066716757_1066716758 -3 Left 1066716757 10:38295028-38295050 CCTGGCTCTTTGTTTGGAAATAA No data
Right 1066716758 10:38295048-38295070 TAAATACTAGCAATAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066716757 Original CRISPR TTATTTCCAAACAAAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr