ID: 1066721041

View in Genome Browser
Species Human (GRCh38)
Location 10:38339330-38339352
Sequence TGTAAGGCTTAAAAATGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066721041_1066721046 16 Left 1066721041 10:38339330-38339352 CCAGTCCATTTTTAAGCCTTACA No data
Right 1066721046 10:38339369-38339391 TCACCTTCATCTCTTTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066721041 Original CRISPR TGTAAGGCTTAAAAATGGAC TGG (reversed) Intergenic
No off target data available for this crispr