ID: 1066723943

View in Genome Browser
Species Human (GRCh38)
Location 10:38370285-38370307
Sequence CAGAGCAATGGGAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066723938_1066723943 -4 Left 1066723938 10:38370266-38370288 CCAGCAGCTAGAGGAGAGACAGA No data
Right 1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066723943 Original CRISPR CAGAGCAATGGGAAGCTGGA GGG Intergenic
No off target data available for this crispr