ID: 1066731810

View in Genome Browser
Species Human (GRCh38)
Location 10:38443088-38443110
Sequence TCTCAACACCACCACGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066731810_1066731813 -10 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731813 10:38443101-38443123 GGTGTTGAGAGATGGTCAGAGGG No data
1066731810_1066731826 29 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731826 10:38443140-38443162 GGCCAGGGAGTTGCTGGGTGGGG 0: 16
1: 9
2: 27
3: 59
4: 666
1066731810_1066731825 28 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731825 10:38443139-38443161 AGGCCAGGGAGTTGCTGGGTGGG 0: 13
1: 31
2: 9
3: 48
4: 425
1066731810_1066731814 -9 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731814 10:38443102-38443124 GTGTTGAGAGATGGTCAGAGGGG No data
1066731810_1066731815 0 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731815 10:38443111-38443133 GATGGTCAGAGGGGAGAAGTAGG No data
1066731810_1066731817 2 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731817 10:38443113-38443135 TGGTCAGAGGGGAGAAGTAGGGG No data
1066731810_1066731816 1 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731816 10:38443112-38443134 ATGGTCAGAGGGGAGAAGTAGGG No data
1066731810_1066731819 8 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731819 10:38443119-38443141 GAGGGGAGAAGTAGGGGAGGAGG No data
1066731810_1066731822 23 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731822 10:38443134-38443156 GGAGGAGGCCAGGGAGTTGCTGG 0: 13
1: 36
2: 22
3: 116
4: 787
1066731810_1066731820 13 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731820 10:38443124-38443146 GAGAAGTAGGGGAGGAGGCCAGG 0: 13
1: 15
2: 16
3: 96
4: 958
1066731810_1066731821 14 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731821 10:38443125-38443147 AGAAGTAGGGGAGGAGGCCAGGG 0: 13
1: 15
2: 15
3: 78
4: 777
1066731810_1066731818 5 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731818 10:38443116-38443138 TCAGAGGGGAGAAGTAGGGGAGG No data
1066731810_1066731824 27 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731824 10:38443138-38443160 GAGGCCAGGGAGTTGCTGGGTGG 0: 13
1: 10
2: 11
3: 65
4: 829
1066731810_1066731823 24 Left 1066731810 10:38443088-38443110 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 1066731823 10:38443135-38443157 GAGGAGGCCAGGGAGTTGCTGGG 0: 31
1: 18
2: 13
3: 67
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066731810 Original CRISPR TCTCAACACCACCACGACCC TGG (reversed) Intergenic
No off target data available for this crispr