ID: 1066740433

View in Genome Browser
Species Human (GRCh38)
Location 10:38514695-38514717
Sequence CCATTACAATTCATTCCATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066740433_1066740440 17 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740440 10:38514735-38514757 TTGAATGGAATGGAATGGAATGG No data
1066740433_1066740437 2 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740437 10:38514720-38514742 AGGAATGGACTCGTATTGAATGG No data
1066740433_1066740441 22 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740441 10:38514740-38514762 TGGAATGGAATGGAATGGAATGG 0: 12039
1: 21879
2: 40950
3: 55555
4: 61440
1066740433_1066740439 12 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740439 10:38514730-38514752 TCGTATTGAATGGAATGGAATGG No data
1066740433_1066740438 7 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740438 10:38514725-38514747 TGGACTCGTATTGAATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066740433 Original CRISPR CCATTACAATTCATTCCATT CGG (reversed) Intergenic
No off target data available for this crispr