ID: 1066740440

View in Genome Browser
Species Human (GRCh38)
Location 10:38514735-38514757
Sequence TTGAATGGAATGGAATGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066740433_1066740440 17 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740440 10:38514735-38514757 TTGAATGGAATGGAATGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066740440 Original CRISPR TTGAATGGAATGGAATGGAA TGG Intergenic
No off target data available for this crispr