ID: 1066740441

View in Genome Browser
Species Human (GRCh38)
Location 10:38514740-38514762
Sequence TGGAATGGAATGGAATGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191863
Summary {0: 12039, 1: 21879, 2: 40950, 3: 55555, 4: 61440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066740433_1066740441 22 Left 1066740433 10:38514695-38514717 CCGAATGGAATGAATTGTAATGG No data
Right 1066740441 10:38514740-38514762 TGGAATGGAATGGAATGGAATGG 0: 12039
1: 21879
2: 40950
3: 55555
4: 61440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066740441 Original CRISPR TGGAATGGAATGGAATGGAA TGG Intergenic
Too many off-targets to display for this crispr