ID: 1066748960

View in Genome Browser
Species Human (GRCh38)
Location 10:38633222-38633244
Sequence GTTCTAAGTGTATGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066748958_1066748960 5 Left 1066748958 10:38633194-38633216 CCAGCATGAGAAGGCTATATATT No data
Right 1066748960 10:38633222-38633244 GTTCTAAGTGTATGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066748960 Original CRISPR GTTCTAAGTGTATGACAATC TGG Intergenic
No off target data available for this crispr