ID: 1066749790

View in Genome Browser
Species Human (GRCh38)
Location 10:38642392-38642414
Sequence CATCATCTCTTAAAAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066749790_1066749792 21 Left 1066749790 10:38642392-38642414 CCACTGACTTTTAAGAGATGATG No data
Right 1066749792 10:38642436-38642458 ATAATATTTTTATAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066749790 Original CRISPR CATCATCTCTTAAAAGTCAG TGG (reversed) Intergenic
No off target data available for this crispr