ID: 1066749855

View in Genome Browser
Species Human (GRCh38)
Location 10:38643518-38643540
Sequence GGAGAATCTCCTTGAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066749852_1066749855 23 Left 1066749852 10:38643472-38643494 CCAAGTTAAACAGTCTAACAAGA No data
Right 1066749855 10:38643518-38643540 GGAGAATCTCCTTGAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066749855 Original CRISPR GGAGAATCTCCTTGAATAAC AGG Intergenic
No off target data available for this crispr