ID: 1066750571

View in Genome Browser
Species Human (GRCh38)
Location 10:38652168-38652190
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066750568_1066750571 24 Left 1066750568 10:38652121-38652143 CCCAGAAACATTCAAGGGTCATT No data
Right 1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG No data
1066750569_1066750571 23 Left 1066750569 10:38652122-38652144 CCAGAAACATTCAAGGGTCATTT No data
Right 1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066750571 Original CRISPR CTGCTTTTGGTGAAGAAAAA AGG Intergenic
No off target data available for this crispr