ID: 1066757209

View in Genome Browser
Species Human (GRCh38)
Location 10:38722972-38722994
Sequence AAACATGAACAAATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066757201_1066757209 14 Left 1066757201 10:38722935-38722957 CCACTGACCCCTAGCTAGAGGTG No data
Right 1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG No data
1066757207_1066757209 5 Left 1066757207 10:38722944-38722966 CCTAGCTAGAGGTGGGTGTAGGA No data
Right 1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG No data
1066757205_1066757209 6 Left 1066757205 10:38722943-38722965 CCCTAGCTAGAGGTGGGTGTAGG No data
Right 1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG No data
1066757204_1066757209 7 Left 1066757204 10:38722942-38722964 CCCCTAGCTAGAGGTGGGTGTAG No data
Right 1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG No data
1066757200_1066757209 15 Left 1066757200 10:38722934-38722956 CCCACTGACCCCTAGCTAGAGGT No data
Right 1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG No data
1066757198_1066757209 28 Left 1066757198 10:38722921-38722943 CCATGCAGCTGTTCCCACTGACC No data
Right 1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066757209 Original CRISPR AAACATGAACAAATGGAGCT TGG Intergenic
No off target data available for this crispr