ID: 1066758086

View in Genome Browser
Species Human (GRCh38)
Location 10:38730395-38730417
Sequence TATGGGGCAGTCGCCGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066758071_1066758086 29 Left 1066758071 10:38730343-38730365 CCTAGTTGGCGGGACCATTAGCT No data
Right 1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG No data
1066758082_1066758086 -9 Left 1066758082 10:38730381-38730403 CCGGACCCCGTGGATATGGGGCA No data
Right 1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG No data
1066758081_1066758086 -8 Left 1066758081 10:38730380-38730402 CCCGGACCCCGTGGATATGGGGC No data
Right 1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG No data
1066758074_1066758086 15 Left 1066758074 10:38730357-38730379 CCATTAGCTCGAGGCGGACGCGG No data
Right 1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066758086 Original CRISPR TATGGGGCAGTCGCCGCCTC CGG Intergenic
No off target data available for this crispr