ID: 1066761217

View in Genome Browser
Species Human (GRCh38)
Location 10:38755264-38755286
Sequence CGCTGGCTGAGGTGAAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066761217_1066761222 -9 Left 1066761217 10:38755264-38755286 CCCGGACTTCACCTCAGCCAGCG No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761217_1066761225 11 Left 1066761217 10:38755264-38755286 CCCGGACTTCACCTCAGCCAGCG No data
Right 1066761225 10:38755298-38755320 GGGTTAATGTTAACTGCAGGAGG No data
1066761217_1066761224 8 Left 1066761217 10:38755264-38755286 CCCGGACTTCACCTCAGCCAGCG No data
Right 1066761224 10:38755295-38755317 AGAGGGTTAATGTTAACTGCAGG No data
1066761217_1066761221 -10 Left 1066761217 10:38755264-38755286 CCCGGACTTCACCTCAGCCAGCG No data
Right 1066761221 10:38755277-38755299 TCAGCCAGCGAAGGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066761217 Original CRISPR CGCTGGCTGAGGTGAAGTCC GGG (reversed) Intergenic
No off target data available for this crispr