ID: 1066761222

View in Genome Browser
Species Human (GRCh38)
Location 10:38755278-38755300
Sequence CAGCCAGCGAAGGAGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066761211_1066761222 23 Left 1066761211 10:38755232-38755254 CCCCGAGAGAGTGGACGTCAGAA No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761213_1066761222 21 Left 1066761213 10:38755234-38755256 CCGAGAGAGTGGACGTCAGAACT No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761217_1066761222 -9 Left 1066761217 10:38755264-38755286 CCCGGACTTCACCTCAGCCAGCG No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761216_1066761222 -8 Left 1066761216 10:38755263-38755285 CCCCGGACTTCACCTCAGCCAGC No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761218_1066761222 -10 Left 1066761218 10:38755265-38755287 CCGGACTTCACCTCAGCCAGCGA No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761212_1066761222 22 Left 1066761212 10:38755233-38755255 CCCGAGAGAGTGGACGTCAGAAC No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data
1066761210_1066761222 24 Left 1066761210 10:38755231-38755253 CCCCCGAGAGAGTGGACGTCAGA No data
Right 1066761222 10:38755278-38755300 CAGCCAGCGAAGGAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066761222 Original CRISPR CAGCCAGCGAAGGAGAGAGA GGG Intergenic
No off target data available for this crispr