ID: 1066761224

View in Genome Browser
Species Human (GRCh38)
Location 10:38755295-38755317
Sequence AGAGGGTTAATGTTAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066761217_1066761224 8 Left 1066761217 10:38755264-38755286 CCCGGACTTCACCTCAGCCAGCG No data
Right 1066761224 10:38755295-38755317 AGAGGGTTAATGTTAACTGCAGG No data
1066761216_1066761224 9 Left 1066761216 10:38755263-38755285 CCCCGGACTTCACCTCAGCCAGC No data
Right 1066761224 10:38755295-38755317 AGAGGGTTAATGTTAACTGCAGG No data
1066761220_1066761224 -3 Left 1066761220 10:38755275-38755297 CCTCAGCCAGCGAAGGAGAGAGA No data
Right 1066761224 10:38755295-38755317 AGAGGGTTAATGTTAACTGCAGG No data
1066761218_1066761224 7 Left 1066761218 10:38755265-38755287 CCGGACTTCACCTCAGCCAGCGA No data
Right 1066761224 10:38755295-38755317 AGAGGGTTAATGTTAACTGCAGG No data
1066761223_1066761224 -9 Left 1066761223 10:38755281-38755303 CCAGCGAAGGAGAGAGAGGGTTA No data
Right 1066761224 10:38755295-38755317 AGAGGGTTAATGTTAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066761224 Original CRISPR AGAGGGTTAATGTTAACTGC AGG Intergenic
No off target data available for this crispr