ID: 1066780757

View in Genome Browser
Species Human (GRCh38)
Location 10:38942735-38942757
Sequence TGGCAAAAAGCGGTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066780757_1066780770 24 Left 1066780757 10:38942735-38942757 CCTGCCACCACCGCTTTTTGCCA No data
Right 1066780770 10:38942782-38942804 GCGGCTTTTTGCCCCCGCCGCGG No data
1066780757_1066780764 5 Left 1066780757 10:38942735-38942757 CCTGCCACCACCGCTTTTTGCCA No data
Right 1066780764 10:38942763-38942785 GCTTTTTGCCCCCGCCGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066780757 Original CRISPR TGGCAAAAAGCGGTGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr