ID: 1066802154

View in Genome Browser
Species Human (GRCh38)
Location 10:39204429-39204451
Sequence GAAGCCAAACAACTTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066802147_1066802154 28 Left 1066802147 10:39204378-39204400 CCATGCCTTCTCTTTGATGTCCT No data
Right 1066802154 10:39204429-39204451 GAAGCCAAACAACTTCAAGCAGG No data
1066802149_1066802154 8 Left 1066802149 10:39204398-39204420 CCTTTGTAGTGAATTACAGCCAC No data
Right 1066802154 10:39204429-39204451 GAAGCCAAACAACTTCAAGCAGG No data
1066802148_1066802154 23 Left 1066802148 10:39204383-39204405 CCTTCTCTTTGATGTCCTTTGTA No data
Right 1066802154 10:39204429-39204451 GAAGCCAAACAACTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066802154 Original CRISPR GAAGCCAAACAACTTCAAGC AGG Intergenic
No off target data available for this crispr