ID: 1066803636

View in Genome Browser
Species Human (GRCh38)
Location 10:39219083-39219105
Sequence CAGGATAAAAACAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066803631_1066803636 1 Left 1066803631 10:39219059-39219081 CCAAATGTGGAAAAGGGAATATC No data
Right 1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066803636 Original CRISPR CAGGATAAAAACAAGAAGGA AGG Intergenic
No off target data available for this crispr