ID: 1066808604

View in Genome Browser
Species Human (GRCh38)
Location 10:39293215-39293237
Sequence GAATCTGCACAGATATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066808604_1066808607 -10 Left 1066808604 10:39293215-39293237 CCCAGCTATATCTGTGCAGATTC No data
Right 1066808607 10:39293228-39293250 GTGCAGATTCTACAAAAACAGGG No data
1066808604_1066808609 18 Left 1066808604 10:39293215-39293237 CCCAGCTATATCTGTGCAGATTC No data
Right 1066808609 10:39293256-39293278 AAAATGCTCAAACAAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066808604 Original CRISPR GAATCTGCACAGATATAGCT GGG (reversed) Intergenic
No off target data available for this crispr