ID: 1066927765

View in Genome Browser
Species Human (GRCh38)
Location 10:41719250-41719272
Sequence AGCTATATGTTAAACTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066927761_1066927765 20 Left 1066927761 10:41719207-41719229 CCATTGGGAAGAACAAAATATCC No data
Right 1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG No data
1066927760_1066927765 21 Left 1066927760 10:41719206-41719228 CCCATTGGGAAGAACAAAATATC No data
Right 1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG No data
1066927763_1066927765 -2 Left 1066927763 10:41719229-41719251 CCCAGATAAAAATTAGAAAGAAG No data
Right 1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG No data
1066927764_1066927765 -3 Left 1066927764 10:41719230-41719252 CCAGATAAAAATTAGAAAGAAGC No data
Right 1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG No data
1066927759_1066927765 30 Left 1066927759 10:41719197-41719219 CCATTGACGCCCATTGGGAAGAA No data
Right 1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG No data
1066927762_1066927765 -1 Left 1066927762 10:41719228-41719250 CCCCAGATAAAAATTAGAAAGAA No data
Right 1066927765 10:41719250-41719272 AGCTATATGTTAAACTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066927765 Original CRISPR AGCTATATGTTAAACTGCTT TGG Intergenic
No off target data available for this crispr