ID: 1066929184

View in Genome Browser
Species Human (GRCh38)
Location 10:41735374-41735396
Sequence CTTCTTTCCAGTTTCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066929184_1066929186 7 Left 1066929184 10:41735374-41735396 CCCACATAGAAACTGGAAAGAAG No data
Right 1066929186 10:41735404-41735426 TGAAACTGCTTTGTGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066929184 Original CRISPR CTTCTTTCCAGTTTCTATGT GGG (reversed) Intergenic
No off target data available for this crispr