ID: 1066950468

View in Genome Browser
Species Human (GRCh38)
Location 10:42111917-42111939
Sequence GGGCAAAAAGCCGTGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066950456_1066950468 11 Left 1066950456 10:42111883-42111905 CCTCAGTGGCAGGAGCCAAAAGC No data
Right 1066950468 10:42111917-42111939 GGGCAAAAAGCCGTGGTGGTGGG No data
1066950463_1066950468 -4 Left 1066950463 10:42111898-42111920 CCAAAAGCCATGGTGGCGGGGGC No data
Right 1066950468 10:42111917-42111939 GGGCAAAAAGCCGTGGTGGTGGG No data
1066950453_1066950468 27 Left 1066950453 10:42111867-42111889 CCGCGGCGGCAAATAGCCTCAGT No data
Right 1066950468 10:42111917-42111939 GGGCAAAAAGCCGTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066950468 Original CRISPR GGGCAAAAAGCCGTGGTGGT GGG Intergenic
No off target data available for this crispr